Supplemental Material STRESS-INDUCED H3S28 PHOSPHORYLATION MODULATES LOCAL HISTONE ACETYLATION LEVELS Anna Sawicka, Dominik Hartl, Malgorzata Goiser, Oliver Pusch, Roman R Stocsits, Ido M Tamir, Karl Mechtler, Christian Seiser Supplemental Methods Supplemental Figure Legends Supplemental Tables (SUPPL. TABLES 1-2, 4-5) Supplemental Tables (SUPPL. TABLES 3, 6-9, provided as txt files) References Supplemental Figures (SUPPL. FIGURES 1-21) Supplemental Methods Histone peptides used for the pull-down assay and mass spectrometry analysis: H3unmodified (3-20): H2N-TKQTARKSTGGKAPRKQLC-CONH2 H3S10phK14ac (3-20): H2N-TKQTARKS(ph)TGGK(Ac)APRKQLC -CONH2 H3unmodified (19-36): H2N-QLATKAARKSAPATGGVKKC-CONH2 H3S28ph (19-36): H2N-QLATKAARKS(ph)APATGGVKKC-CONH2 Histone peptide pull-down assay For histone peptide pull down assays, 0.1 mg of synthetic peptides (peptide sequences are given above), corresponding to amino acids 3-20 and 19-36 of histone H3 (numbered from N-terminus of histone H3) with a C-terminal cysteine added were coupled to 40 µl (bed volume) of SulfoLink Coupling Resin (Thermo Scientific) according to the manufacturerʼs instructions. Peptide-coupled resin was incubated overnight at 4oC on a roller with 500 µg of nuclear extract (isolated from proliferating HeLa cells treated with 188.5 nM Anisomycin for 1 hour) diluted to 0.5 µg/µl in the binding buffer (20 mM Tris-HCl pH 8.0, 135 mM NaCl, 0.5% NP40, 10% glycerol). The beads were washed 3 times 20 mM Tris-HCl pH 8.0, 135 mM NaCl, 0.5% NP40, 10% glycerol, followed by two washes with 200 mM NaCl, 50 mM Tris-HCl pH 8.0, 0.1 % SDS, 0.1% NP40, 0.5% sodium deoxycholate. Bound proteins were eluted by heating at 95oC for 5 min in 20 µl of Laemmli Sample Buffer and analyzed by Western Blotting. All washing buffers as well as the binding buffer were supplemented with Complete Protease Inhibitor (Roche). Mass spectrometry analysis Histone pull down assay was performed as described above with the following changes: 1 mg of nuclear extract from HeLa cells treated for 1 h with 188.5 nM 2 anisomycin was used, together with 0.4 mg of synthetic peptides and 200 µl (bed volume) of SulfoLink Coupling Resin. Following 2 washes with 200 mM NaCl, 50 mM Tris-HCl pH 8.0, 0.1% SDS, 0.1% NP40, 0.5% sodium deoxycholate, the samples were washed 5 times with 20 mM Tris-HCl pH 8.0, 135 mM NaCl, 10% glycerol (without protease inhibitors) and 2 times with 150 mM NaCl. The samples were washed 3 times with 25 mM ammonium bicarbonate (ABC) and then resuspended in 30 µl of ABC, supplemented with 200 ng of LysC and incubated at 37oC for 4 h. The LysC fraction was taken out and the beads were resuspended in 30 µl of 100 mM glycine, pH 2.0. The glycine elution was repeated twice and all three elutions were pooled. Then both fractions, LysC and glycine fraction were subjected to alkylation and reduction followed by tryptic digestion with 200 ng of trypsin in 37oC overnight. The digest was terminated by adding 10 µl of 10% TFA. 50% of each fraction was pooled and run for 3 h on the Ultimate 3000 HPLC RSLC nano system (Thermo Scientific) coupled to Q Exactive mass spectrometer with Proxeon nanospray source. For peptide identification, the .RAW-files were loaded into Proteome Discoverer (version 1.4.0.288, Thermo Scientific) and MS/MS spectra were searched using Mascot 2.2.07 (Matrix Science) against the human Uniprot database with the FDR cutoff of 0.5% at PSM (peptide spectrum matches) level and minimum 2 peptides per protein. The complete list of identified proteins is contained in Supplemental Tables 7-9: Supplemental Table 7 contains the list of identified proteins and number of unique peptides, Supplemental Table 8 contains the coverage details and Supplemental Table 9 contains the PMS information. Primers used for quantitation of gene expression: mRNA_Rpl13a_F: GGAGAAACGGAAGGAAAAGG mRNA_Rpl13a_R: ACAGGAGCAGTGCCTAAGGA mRNA_Dusp1_F: CTCCAAGGAGGATATGAAGCG (Auger-Messier et al. 2013) mRNA_Dusp1_R: CTCCAGCATCCTTGATGGAGTC 3 mRNA_Optn_F: GTGGCCGGACCTGTTACC mRNA_Optn_R: CAAACAACAGGCGCTCTTCC mRNA_Ube2v2_F: TATTGGGCCACCAAGGACAAA mRNA_Ube2v2_R: TGATGGAGGAGCTTCTGGGTA mRNA_Mafk_F: GAAGCGCTTGTGAAGAGTGC mRNA_Mafk_R: CCTTCAATGCCTTGTTGGGC mRNA_Traf1_F: CACCAATGTCACCAAGC mRNA_Traf1_R: CAGGAGAGCATCGTATTC mRNA_Nfil3_F: TTTCTTTTCCCCCTCACGGA mRNA_Nfil3_R: CCTCGTCCTACAGACCGGAT mRNA_Ell_F: GGAGTTACGGGTTGTCGTGT mRNA_Ell_R: AGAGATGTGCCCTTGGCTTC mRNA_Tank_F: TTGACCCTTGATGAACCACA mRNA_Tank_R: ATCCCTTTCGTGATGCAGAG mRNA_Egr3_F: GGTGACCATGAGCAGTTTGC mRNA_Egr3_R: TCCATCACATTCTCTGTAGCCA mRNA_Fos_F: ATCTGTCCGTCTCTAGTG mRNA_Fos_R: GCTTGGAGTGTATCTGTC Adapters and primers used for scRNA-seq: 3ʼadaptor_PE: 5ʻ-/5Phos/rArGrATCGGAAGAGCGGTTCAGC/3ddC/ -3ʻ 5ʼadaptor_PE: 5ʻrArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCr UrCrUrUrCrCrGrArUrCrU-3ʻ RT_Primer_PE (primer for reverse transcription): 5ʻ- TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT -3ʻ Library amplification primers: PE_PCR_Primer_1.0 (forward primer): 5ʻ-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG ACGCTCTTCCGATCT-3ʼ PE_PCR_Primer_2.0 (reversed primer): 5ʻ-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGC TGAACCGCTCTTCCGATCT-3ʼ Antibodies used for Western Blotting and dot blots: H3S28ph (Sigma, cat number H9908), dilution 1:1000 H3S10ph (Santa Cruz Biotechnology, cat number 8656R), dilution 1:5000 H3S10ph (Active Motif, cat number 39253), dilution 1:5000 Anti-histone H3 C-terminus (Abcam, cat number 1791), dilution 1:50000 Lamin A/C (clone 4C11, Active Motif, cat number 39287), dilution 1:500 MSK1 (Sigma, cat number M5437), dilution 1:2000 MSK2 (Bethyl, cat number A302-746A), dilution 1:2000 RNAPIIS5ph (Bethyl, cat number A300-655A), dilution 1:5000 RNAPIIS2ph (Bethyl, cat number A300-654A), dilution 1:5000 4 β-Actin (Sigma, cat number A5316), dilution 1:20000 HDAC1 (10E, Seiser Lab, available at Millipore cat number 06-720), dilution 1:500 HDAC2 (3F3, Seiser Lab, available at Millipore cat number 05-814), dilution 1:1000 14-3-3zeta (Santa Cruz Biotechnology, cat number sc-1019), dilution 1:1000 mSin3A (AK-11) (Santa Cruz Biotechnology, cat number sc-767), dilution 1:500 MTA1 (C-17) (Santa Cruz Biotechnology, cat number sc-9446), dilution 1:500 Antibodies used for chromatin immunoprecipitation: H3S28ph (Sigma, cat number H9908), 4 µg of antibody, 100 µg of chromatin RNAPIIS5ph (Bethyl, cat number A300-655A), 4 µl of antibody, 25 µg of chromatin RNAPIIS2ph (Bethyl, cat number A300-654A), 4 µl of antibody, 25 µg of chromatin H3S10ph (Santa Cruz Biotechnology, cat number 8656R), 4 µg of antibody, 50 µg of chromatin H3S10ph (Seiser Lab), 10 µl of serum, 50 µg of chromatin H3S10phK14ac (Seiser Lab), 10 µl of serum, 100 µg of chromatin H3K9ac (Millipore, cat number 06-942), 4 µg of antibody, 25 µg of chromatin H3K4me3 (Millipore, cat number 07-473), 4 µg of antibody, 25 µg of chromatin H3K27ac (Abcam, cat number ab4729), 4 µg of antibody, 25 µg of chromatin H4ac (Millipore, cat number 06-866), 4 µl of serum, 25 µg of chromatin Histone H3 (Active Motif, cat number 61475), 4 µg of antibody, 25 µg of chromatin p300 C-20 (Santa Cruz Biotechnology, cat number sc-585), 4 µg of antibody, 50 µg of chromatin PCAF H-369 (Santa Cruz Biotechnology, cat number sc-8999), 4 µg of antibody, 50 µg of chromatin Gcn5 H-75 (Santa Cruz Biotechnology, cat number sc-20698), 4 µg of antibody, 50 µg of chromatin mSin3A (K-20) (Santa Cruz Biotechnology, cat number sc-994X), 4 µg of antibody, 25 µg of chromatin HDAC1 (Abcam, cat number ab7028), 4 µg of antibody, 25 µg of chromatin HDAC2 (Bethyl, cat number A300-705A), 4 µl of antibody, 25 µg of chromatin Primers used for ChIP-qPCR: Dusp1(+108)_F: GACTTAGGGCCACAGGACAC Dusp1(+108)_R: AAGAAGGAGCGACAATCCAA Dusp1_+2517_F: TGTTTGAGGCAGTTTCTTCG Dusp1_+2517_R: TGAGGTATTTGGTTCTTCTATGAG Optn(-170)_F: TCCAAGAGAGGCTCTATCCCTA Optn(-170)_R: CCAAGAAATTTCCCAGACCA Optn(+42126)_F: GCCCAGCACAGCAGTACTTT Optn(+42126)_R: CCGGTGAGGCTATAAACCAA Ube2v2(-234)_F: TTCCCTTGGACACACTGACA Ube2v2(-234)_R: GTTGGTTCATCGGTTGTCCT Ube2v2(+38949)_F: GCAGGCGATTACAAGTTCCT Ube2v2(+38948)_R: CGGTGTCACAACAAGTGCTC Fosl1(+123)_F: CCCCCGTGGTGCAAGTGGTT (Drobic et al. 2010) Fosl1(+123)_R: TGGCGGCTGCGGTTCTGACT Fosl1(-962)_F: TCACCAGACTCAGCCACTTAC (Drobic et al. 2010) Fosl1(-962)_R: GCCATCATAACCCCCACT Mafk(+581)_F: GCCAAGGTCCCATCCAACTCTG Mafk(+581)_R: TGATTTCTCGCCGCACGCTC 5 Mafk(+9671)_F: GGGGTTCTCTGGGGCTTAG Mafk(+9671)_R: CCTGTCTACTTCGTTCCTGTTC Traf1(+2630)_F: GGTGCTGCCTCATTCTTACC Traf1(+2630)_R: ACTTGCTCCTGCGATCCTTA Traf1(+13803)_F: CCCCAGTATCCAGTGCAAAT Traf1(+13803)_R: ACAGGGAAGACACGGTTTTG Nfil3(+500)_F: CCGGATTTCAGGAAAATTGA Nfil3(+500)_R: GACTCAACCCTCCCCTTAGC Nfil3(+13547)_F: TCAAGAGATTCATAGCCACACAAC Nfil3(+13547)_R: ACACAAGGACACCCAGACAG Tank(+1023)_F: CCTTCTTGCGAAAAGCCATA Tank(+1023)_R: AACGTGAGTAGGCGCCTTTA Tank(+56840)_F: GTCAAGTTTCCGCCTATGG Tank(+56840)_R: AAAGTTTCCTGGGTTGTCTC Ell(+96)_F: AGGGTGTCGGTGTTC Ell(+96)_R: AGGTATCGCCAGGTG Ell(+38299)_F: TTGTTGAGTTTGAGTTCTGGGTAGG Ell(+38299)_R: GGGTCTTTGTGTAGTCTTGTCTGTC Detailed description of computational analysis Unless specified otherwise, the analysis was performed using Mac OS X system version 10.6.8, R version 3.0.1 (R Development Core Team 2014) and Bioconductor version 2.12 (Gentleman et al. 2004). We used Mus musculus genome annotation from July 2007 (NCBI37/mm9) throughout all our analysis. Mapping of short reads Mapping of the short reads was performed by the CSF NGS unit. In the case of ChIP- seq experiments, following the quality control, short reads were mapped to the mouse genome using Bowtie version 12.5 (Langmead et al. 2009), allowing up to two mismatches and retaining reads