1701-1708.qxd 23/4/2010 11:02 Ì ™ÂÏ›‰·1701 ONCOLOGY REPORTS 23: 1701-1708, 2010 BCL2L10 is frequently silenced by promoter hypermethylation in gastric cancer RINTARO MIKATA1, KENICHI FUKAI1, FUMIO IMAZEKI1, MAKOTO ARAI1, KEIICHI FUJIWARA1, YUTAKA YONEMITSU1, KAIYU ZHANG1, YOSHIHIRO NABEYA2, TAKENORI OCHIAI2 and OSAMU YOKOSUKA1 Departments of 1Medicine and Clinical Oncology, and 2Frontier Surgery, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo Ward, Chiba 260-8670, Japan Received November 12, 2009; Accepted February 9, 2010 DOI: 10.3892/or_00000814 Abstract. In gastric cancer, several tumor suppressor and Introduction tumor-related genes are silenced by aberrant methylation. Previously, we demonstrated that BCL2L10, which belongs Transcriptional silencing of tumor suppressor genes by to the pro-apoptotic Bcl-2 family, was transcriptionally promoter hypermethylation is a common feature of human repressed by promoter hypermethylation and that its cancer. In gastric cancer, several tumor suppressor and overexpression caused apoptosis and growth inhibition of tumor-related genes, including CDKN2A (p16) (1), RUNX3 gastric cancer cells. In this study, we investigated the (2) and hMLH1 (3), have been reported to be silenced by methylation status of BCL2L10 and its expression in 21 aberrant methylation. Recently, the number of genes known gastric cancer tissues and corresponding non-neoplastic to be inactivated by DNA methylation in gastric cancer, such mucosae along with the methylation status of p16, RUNX3, as genes related to cell cycle control (4), cell proliferation (5) and hMLH1 genes by using methylation specific PCR. and apoptosis (6), have accumulated. We previously In addition, we examined the association between the analyzed the genes induced by the demethylating agent 5- methylation status of each gene and the expression of EZH2, aza-2'-deoxycytidine (DAC) in gastric cancer cell lines using which was associated with DNA methylation of its target a cDNA microarray containing 30,000 genes. We found that genes. As a result, aberrant methylation of BCL2L10 was BCL2L10, which belongs to the proapoptotic Bcl-2 family, detected in 38% of gastric cancer and in 24% of corres- was transcriptionally repressed by promoter hypermethy- ponding non-neoplastic mucosae and correlated with low lation (7). BCL2L10 (also called Diva) has been reported expression of BCL2L10. Methylation of p16, RUNX3, and to directly interact with Apaf-1 and to displace Bcl-XL, sug- hMLH1 was found in gastric cancer and in corresponding gesting it inhibits Bcl-XL function and promotes apoptosis non-neoplastic mucosae at almost similar frequencies as (8). Conversely, it was also reported that BCL2L10 had an previous reports. Expression of EZH2 was detected more anti-apoptotic effect on human glioma cells (9). The previous frequently in tumors (48%) as compared to corresponding observations that BCL2L10 was associated with either the non-neoplastic mucosae (10%) (p=0.006), however, no anti-apoptotic proteins Bcl-2 and Bcl-XL or with the pro- significant difference was found between expression of apoptotic protein Bax (10) suggest that BCL2L10 could EZH2 and the methylation frequency of each gene. In exert different effects on cells under certain circumstances conclusion, our data suggest that silencing of BCL2L10 by depending on the cellular context. Previously, we demon- aberrant methylation is a common feature in gastric cancer strated that overexpression of BCL2L10 caused apoptosis and its inactivation may be involved in the early steps of and growth inhibition of gastric cancer cells (7). Gastric gastric carcinogenesis. carcinogenesis is thought to consist of a multi-step process composed of genetic and epigenetic disorders. Methylation- mediated down-regulation of BCL2L10 may be one such _________________________________________ epigenetic event involved in gastric carcinogenesis. Recently, it was reported that overexpression of EZH2 Correspondence to: Dr Fumio Imazeki, Department of Medicine (Enhancer of Zeste homolog 2), which is a member of the and Clinical Oncology, Graduate School of Medicine, Chiba polycomb group (PcG) of proteins, occurred in a variety of University, Inohana 1-8-1, Chuo Ward, Chiba 260-8670, Japan human malignancies including gastric cancer (11,12). The E-mail: [email protected] PcG proteins are believed to act as multiprotein complexes that repress target gene expression through modification Key words: methylation, gastric cancer, BCL2-like10, EZH2 of chromatin structure. EZH2 is the catalytically active component of polycomb repressive complex 2 (PRC2) and is capable of methylating lysine 9 (H3K9) and lysine 27 (H3K27) of histone H3 (13,14). Moreover, EZH2 was 1701-1708.qxd 23/4/2010 11:02 Ì ™ÂÏ›‰·1702 1702 MIKATA et al: BCL2L10 IS FREQUENTLY SILENCED IN GASTRIC CANCER Table I. Primer sets for MSP. ––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– Genome Product Annealing Primer set position Sequence size temperature Cycles ––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– MSP BCL2L10-M (S) -70 AATATATCGGGGGTCGGGGGTC 180 62 35 BCL2L10-M (AS) +110 AACTCGATACGCTCCCGCAACG BCL2L10-U (S) -70 AATATATTGGGGGTTGGGGGTT 186 59 35 BCL2L10-U (AS) +116 AACAACAACTCAATACACTCCCA P16-M (S) +167 TTATTAGAGGGTGGGGCGGATCGC 150 65 35 P16-M (AS) +316 GACCCCGAACCGCGACCGTAA P16-U (S) +167 TTATTAGAGGGTGGGGTGGATTGT 151 60 35 P16-U (AS) +317 CAACCCCAAACCACAACCATAA RUNX3-M (S) -262 TTACGAGGGGCGGTCGTACGCGGG 220 65 35 RUNX3-M (AS) -42 AAAACGACCGACGCGAACGCCTCC RUNX3-U (S) -262 TTATGAGGGGTGGTTGTATGTGGG 220 63 RUNX3-U (AS) -42 AAAACAACCAACACAAACACCTCC hMLH1-M (S) -675 TATATCGTTCGTAGTATTCGTGT 153 60 35 hMLH1-M (AS) -523 TCCGACCCGAATAAACCCAA hMLH1-U (S) -721 TTTTGATGTAGATGTTTTATTAGGGTTGT 124 60 35 hMLH1-U (AS) -598 ACCACCTCATCATAACTACCCACA ––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– Sense (S) and antisense (AS) primers used for PCR amplification and the size of respective PCR products are shown. Genome position indicates the nucleotide position relative to the transcription start site. –––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– reported to be required for DNA methylation of its target mainly (>80%) of carcinoma tissue. The status of H. pylori genes through recruitment of DNA methyltransferases (15). infection was also histologically confirmed. All patients had In this study, we clarified the methylation status of given informed consent for their participation, and the Ethics BCL2L10 and its expression in gastric cancer tissues and Committee approved these studies. corresponding non-neoplastic mucosae by performing methy- lation-specific PCR (MSP) and real-time RT-PCR. We also Sodium bisulfite DNA sequencing and methylation specific compared it with the methylation status of p16, RUNX3, and PCR (MSP). Genomic DNAs were extracted using a QIAamp hMLH1 genes that have been well documented in gastric DNA Mini kit (Qiagen, Hilden, Germany) according to the cancer. In addition, to determine whether EZH2 influenced instructions of the manufacturer. Using extracted DNA, bisul- the methylation status of these four genes, we examined fite modification of DNA (1 μg) was performed using the the association between the methylation status of each gene CpGenome™ DNA modification kit (Chemicon International and the expression level of EZH2. Inc., CA, USA) according to the manufacturer's instructions. Modified DNA was purified using a DNA purification kit Materials and methods (Qiagen). To examine the DNA methylation status of the BCL2L10, p16, RUNX3, and hMLH1 genes, we performed Tissue samples and DNA extraction. Gastric cancer tissues MSP. For detection of aberrant methylation of these genes, and corresponding non-neoplastic mucosae were obtained modified DNA was amplified using AmpliTaq Gold DNA from 21 patients (male 14; female 7; median age 70 years Polymerase (Applied Biosystems), and primers specific for old; range, 56-85 years) who underwent surgical resection the methylated and unmethylated sequences of each gene at Chiba University Hospital, Chiba, Japan between 2005 (17-19) are shown in Table I. Location of MSP primers for and 2006. All resected specimens were frozen immediately BCL2L10 in its CpG island is shown in Fig. 1. PCR products in liquid nitrogen and stored at -80°C until use. Histo- (5 μl) were run on a 3% agarose gel and visualized by SYBR- pathological examination was performed according to the Green (FMC, Rockland, ME) staining. CpGenome Universal Japanese Classification of Gastric Carcinoma (16). Based Methylated DNA (Chemicon International, Temecula, CA) on the histological findings, the 21 tumors were classified was used as a positive control for methylation. as 4 well differentiated, 6 moderately differentiated, and 11 poorly differentiated (including signet ring cell and mucinous Semiquantitative RT-PCR and real-time RT-PCR. Total RNA carcinomas) adenocarcinomas. We microscopically con- was extracted with an RNeasy Mini Kit (Qiagen) according firmed that the tumor specimens used in this study consisted to the manufacturer's instructions. First strand cDNA was 1701-1708.qxd 23/4/2010 11:02 Ì ™ÂÏ›‰·1703 ONCOLOGY REPORTS 23: 1701-1708, 2010 1703 Biosystems Japan (Tokyo, Japan). The BCL2L10 gene was amplified on the same plate as the ß-actin reference using the TaqMan Universal PCR Master Mix and
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages8 Page
-
File Size-