Supplementary Materials s34

Supplementary Materials s34

<p>Supplementary materials</p><p>Article Title High-resolution genetic mapping and candidate gene identification of the SLP1 locus that controls glume development in rice</p><p>Journal Name Theoretical and Applied Genetics</p><p>Author names Sheng-Shan Wang, Chang-Sheng Wang, Tung-Hai Tseng, Ya-Lin Hou, and Kai-Yi Chen</p><p>Corresponding Author Kai-Yi Chen Department of Agronomy, National Taiwan University No. 1, Sec. 4, Roosevelt Rd., Taipei 10617, Taiwan Email: [email protected] Telephone: +886 2 3366-4766 Fax number: +886 2 2362-0879</p><p>1 S_Table1. Polymorphic markers used in the high-resolution mapping experiments. </p><p>Marker ID Amplicon position forward primer reverse primer Tm corresponding to the PAC P0702E04 RM6070 CTCCCAGTCACCCTGCTACTCC TGTGTCACGTTCGTTGCTACTCC 55 D275 GAGAGAGCTCAGGACTAACCAT CATGTAGAGATCCCTAACCATTT 55 D309 GCACGCACGCATATTTAGATT GACAGTATTGTTTCATCACGCTAAT 55 SNP333 07272 – 08764 bp AGATTCAAAGGCAAGATATGCAA CCTGAAAATGGAATCACCAATTA 57 SNP471 15137 – 15663 bp GCACCATAACTCCTACTTCCTC CAACCCTTCCTGTATTCTAATC 57 D364 38721 – 38946 bp AATCACAAAGCACACAAAAGTGA CACCAATACTTACGCTCGGTTTA 57 D374 48828 – 49024 bp ATTACTCTTTCGGACTCAAACTC AACCTTGTAAGGACTAGGAGTGA 57 SNP515 59562 – 60313 bp GTCCCGCAAAGAAGCAA GGCCTGTTTATAGCCAACTACTA 57 SNP386 60856 – 61541 bp TCCATTCACCACCACAAACT TCCCCAAACTAATGGTGAAGA 55 D399 73538 – 75185 bp ATCTTGTCCAAGTAATCGTAGGTT AATTTCAGTTATGTTTTGGATGG 57 RM447 91331 – 91442 bp ACGGGCTTCTTCTCCTTCTCTCC TCCCTTGTGCTGTCTCCTCTCC 55 RM23557 CTCTGCAAACACTGTGACTTTGG ATGATCTTGAGGGTGTTCTTCG 55 Tm: annealing temperature.</p><p>2 S_Table2. Candidate genes for the SLP locus. gene name Locus name PAC ID Accession No. of cDNA OsSPL16 Loc_Os08g41940.1 GI42761368 : 42792 - 47823 AK109469 OsMADS45 Loc_Os08g41950.2 GI42761368 : 49550 - 53886 AK100263 OsMADS37 Loc_Os08g41960.1 GI42761368 : 60600 - 70641 AK242980 </p><p>3 S_Table3. The primer pairs used for DNA sequencing. </p><p>Primer ID ForwArd primer Reverse primer Tm Teos-1 CCAAGAAAAGCGACACCAGT GAGATTGTGCAAAGCCAAAA 60 Teos-2 TCCACTTCTTTTCAGCGTCA AACCAGGTGCTACCGTGCTA 57 Teos-3 TGAATATGACCGTCTGCTTCC CCTAGTACCAATAAGTCTGAAACTGGA 57 Teos-4 CCTGAACACCCTGATTGGAT GCATGCAGCAGCATAATGA 57 Teos-5 GTGGTGTGCTCCTTTACACAGT AGTTCATGGGATCTGGCTGT 57 Teos-6 AAGCGACTAGATGGGCACAA CTTCCTGGAGGAAAGGGAAG 57 Teos-7 ATTTCGTTGGCTCCACCTC GATCTCGCGAGGAACTGATT 57 Teos-1-1 AGCTTACGCGGGAGCTAA CAGTGAATTTGGCGGGAAG 60 Teos-1-3 CCAAGAAAAGCGACACCAGT CATGAGGGAAGGCTGAAAAG 60 Teos-2-1 GGTGCAAGGAGGACCTGAG GAAACGAGACAGCCGGATAG 65 Teos-3-1 TTTCATTGATCCATTTCATCCA AGGGAGAAGTGCAAGAACCA 57 Teos-4-1 GTCTCGGTTTGTTGGAAAGG CTTTGTTCAGAAAACAGCAAGG 57 Teos-4-2 ACCACCTTGACCCCTGTTTT GACTGTCCCCACTGGGTAAT 57 Teos-5.6 GTGAGAACTGTGGTGCATCG GTGAGAATCTTGCCCCTGAA 57 Teos-6-1 AAGCGACTAGATGGGCACAA TGATCATCCCTGTCCAGCTT 57 Teos-7-1 GCAAGATTCTCACCGTTCG CCATGGCAGAAAAGAACAGA 57 Teos-7-2 ATTCAGGGGCAAGATTCTCA TGAAACTAAGGCAGCAACATACA 57 Teos-7-4 CGTTTCTCAGAACTGTGGTTCA GCCTAAGATCTGATCCAGAAGC 57 Teos-7-3-1 CATCTAATGCATTGAACCATATCT TGAAGGCCAGAGATGAGAGG 57 Teos-7-3-2 AAGTGCTCGACTCCGATTGT TGAAACTTCTCTGTTCCAAACG 57</p><p>SRF-1 TCGAGCTCTCAACTAGCCTAA GGTTGGAGAAGATGATGAGG 57 SRF-2 TGCTCAAGAAGGCGTACGAG TTCTTGCAAGTCCCCCTATG 57 SRF-3 ATACAGAGATCAACGGCTTCA GAGTTTATTCACATCATTCTTGCAG 57 SRF-4 TGCAAGAGCGGTTTTGTACC TTATGCAGTTGCATGTTGGAA 57 SRF-5 GCTGTCGACCAGCTGATAA TGGTCAACCAGATGTTTTGTCT 57 SRF-6 GCAGCCCTATTGTTGATCGT TCCTCCAGCTACAGTTTTTCA 57 SRF-7 TGCAGATATCATGGAATGGA CACACAAACAGGCTACATACGA 57 SRF-2-1 GTGGTAAAGAAGACGGATGGAC TGCCTTCAGTTTGAGGTATTCA 57 SRF-4.5 CATCAATACCTTTGTTCAGATTCA CCACACATAGGGGTAGAAGAGTAT 57</p><p>MADS-1 TCCATTCACCACCACAAACT TCCCCAAACTAATGGTGAAGA 57 Tm: annealing temperature.</p><p>4 S_Figure1. Genotypes of a SNP marker using CelI enzyme digestion. Samples A, B, </p><p>F1, F2, A+F2 were PCR products treated with CelI enzyme. The F1 sample showed minor bands (the red arrows) below the major band. If the F2 sample showed minor band, the genotype of this sample is heterozygous. When the F2 sample only showed the major band as the example showed here, additional A+F2 sample mixture was required to determine the genotype of the F2 sample. As the example shown here, the </p><p>F2 sample had the same genotype as the sample B when minor band was detected in the A+F2 sample mixture. Otherwise, if both the F2 sample and the A+F2 sample mixture showed only one major band, the F2 sample had the same genotype as the sample A.</p><p>5 S_Figure2. Determination of the optimal cycle numbers of RT-PCR for the three candidate genes of SLP1 (OsSPL16, OsMADS45 and OsMADS 37) and the internal control (eEF-1α). Cycle numbers 30, 28, 30 and 27 were selected for OsSPL16, </p><p>OsMADS45, OsMADS37 and eEF-1α, respectively. The cycle number was chosen based on two criteria: the quantity of PCR products was able to be observed clearly on the gel image and did not reach plateau level.</p><p>6</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    6 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us