<p> Presentation "Evolutieve Ecologie"</p><p>The following are some basic guidelines to give you a quick start. But try to experiment with the software a little more ...</p><p>Choosing your sequences</p><p>All URL's can be reached via www.amphibia.be/links NCBI and Blast are useful!</p><p>-- > Retrieve your sequences using smart queries !</p><p>For example: You are looking for the sequences used in the paper by Biju & Bossuyt (2003):</p><p>It takes one minute to get the CXCR4 sequences used in that paper if you do the following: Search nucleotide "Biju Bossuyt CXCR4" Display Fasta and Send to text </p><p>It takes hours if you look for these sequences one by one!</p><p>Preparing your sequences for alignment</p><p>1) Prepare a file containing your sequences (per gene!) in fasta format, as follows:</p><p>>Name_of_species1 TGGCTGTgGTCCTGCAGTTCCTGAGAAAGCAGTACGTTTTTCGTTCACAATCA TGAACATCAGTGTTCCCAACAACAGTGGGTCTATTAGAATCTTTGAAGAGAC TAAACC</p><p>> Name_of_species2 TGGCTGTGGTCCTGCAGTTCCTGAGAAAGCAGTACGTTTTTCGTTCACAATCA TGAACATCAGTGTTCCCAACAACAGTGGGTCTATTAGAATCTTTGAAGAGAC TAAACC etc...</p><p>2) Save as text file (text only) Alignment using the software ClustalX</p><p>1) File menu - Load sequences 2) Load the txt file 3) Check first if the number and length of sequences is what you expected. 4) Alignment - output format options NBRF/PIR format output order = input 5) Alignment - Do complete alignment</p><p>Correcting the alignment using the software MacClade</p><p>1) Open NBRF-PIR file 2) Delete regions with insufficient information from both ends 3) Define bad-aligned regions: Characters - Include-Exclude chars - Exclude 4) Save as "filename.MacClade"</p><p>Phylogenetic analyses - software Paup</p><p>1) Open software Paup 2) File - import data 3) Set Format to NBRF-PIR - import "filename.MacClade"</p><p>For further instructions, see instructions during classes, the manual of Paup, and the FAQ on the website. Note: For two genes, don't forget to include "interleave" on the FORMAT line See "DNA.paup" example file. The easiest is to paste your data in this file, so you make no mistakes.</p><p>Mr Bayes 2.01</p><p>Preparing your file: Do EXACTLY as follows: - execute your datafile (in which you have two blocks of genes) - File - export (Phylip3.x - Macintosh): your file is saved as a ".dat" file - Import the .dat file (Phylip3.x - nucleotide) - delete the line with square brackets completely - change "nucleotide" in "dna" - Paste the MrBayes block (copy from example file "dna.bayes") completely under your data set - Save the file as "mybayes" and put it in the MrBayes folder (where the application is) - Dubble click the application MrBayes - type "execute mybayes" -- It should start running ...</p>