<p>Table S1. Primers used in the work. Restriction sites are underlined</p><p>Primers 5’-3’sequence Target region dGlk(Acc65I) TTGGTACCTCGATGCGTTGATTTAT glk gene dGlk(SacII) AAGAGCTCAATTCGCGTCGTCCAT glk gene</p><p>LP-SPS-N(BglII) TTAGATCTGTTTGATTTTTAAGAGTCGAGGATT sps gene</p><p>LP-SPS-N(NcoI) TACCATGGCGATTTGCCGAAGGCTATTT sps gene</p><p>PP-SPS-C(SacII) TTCCGCGGTCGGCAATGGCAATTTTAAAGA sps gene</p><p>PP-SPS-C(SacI) TAGAGCTCGCCCAATCCGGTTCGATTTCA sps gene</p><p>Lp-ams-F(BglII) ATATAGATCTAGTTGGCGGCGCTTTATCCGGTTTCG ams gene</p><p>Lp-ams-R(Acc65I) AATTGGTACCAGGTATGATTCAACACAACGTCCAAAG ams gene pp-ams-F(SacII) TTCCGCGGAACATGCGATCGATATTGCGT ams gene pp-ams-R(SacI) ATAGAGCTCGCTTCGCGCACGGTCTCGGCGCCAA ams gene Glk-N(NdeI) TACATATGATTCTGGCAGGCGAT glk gene Glk-C(XhoI) AACTCGAGGCCGAAATAACTGATC glk gene Table S2. Distribution of putative glk, glgA and sps genes in aerobic methylotrophic bacteria. Database www.genoscope.cns.fr, http://www.ncbi.nlm.nih.gov/, https://img.jgi.doe.gov was used for analysis. Quantity of the plus reflects the number of genes in bacterial genome.</p><p>Bacteria glk glgA sps Methanotrophs Gammaproteobacteria Methylobacter luteus IMV-B-3098T + + + Methylobacter marinus A45 + + + Methylobacter sp. BBA5.1 + + + Methylobacter tundripaludum SV96 ++ + + Methylobacter whittenburyi ACM 3310 + + + Methylocaldum szegediense O-12 + ++ + Methylocaldum sp. 175 + +++ + Methylogaea oryzae JCM 16910 + +++ - Methylococcus capsulatus Bath + ++ - Methylococcus capsulatus Texas + ++ - Methyloglobulus morosus KoM1 + ++ + Methylohalobius crimeensis 10Ki + ++ ++ Methylomarinum vadi IT-4 + + + Methylomicrobium agile ATCC 35068 + + + Methylomicrobium album BG8 + + + Methylomicrobium alcaliphilum 20Z + ++ + Methylomicrobium buryatense 5G + ++ + Methylomicrobium kenyense AMO1 + ++ + Methylomonas denitrificans FJG1 + + + Methylomonas methanica MC09 + + + Methylomonas sp. 11b + + - Methylomonas sp. MK1 + + - Methylosarcina fibrata AML-C10 + + ++ Methylosarcina lacus LW14 + + - Methylovulum miyakonense HT12 + + - Alphaproteobacteria Methylocapsa acidiphila B2 + - - Methylocapsa aurea KYG + + - Methylocapsa palsarum NE2 + + - Methylocella silvestris BL2 + + - Methyloferula stellata AR4 + - - Methylocystis sp. SB2 - + - Methylocystis parvus OBBP - + - Methylocystis rosea SV97T - + - Methylocystis sp. ATCC 49242 - + - Methylocystis sp. LW5 - - - Methylocystis sp. SC2 - + - Methylosinus sp. LW3 - - - Methylosinus sp. LW4 - - - Methylosinus trichosporium OB3b - - - Verrucomicrobia</p><p>Methylacidiphilum fumariolicum SolV + + - Methylacidiphilum infernorum V4 + ++ - Methylacidiphilum kamchatkense Kam1 + + - Methylotrophs Alphaproteobacteria Methylobacterium extorquens AM1 + ++ + Methylobacterium mesophilicum SR1.6/6 + + + Methylobacterium nodulans ORS 2060 + + - Methylobacterium radiotolerans JCM 2831 + + - Methylobacterium aquaticum DSM 16371 + + - Methylobacterium brachiatum 111MFTsu3.1M4 + + + Methylobacterium chloromethanicum CM4 + + + Methylobacterium gossipiicola Gh-105 + + + Methylobacterium komagatae DSM 19563 + + + Methylobacterium oryzae CBMB20 + + + Methylobacterium phyllosphaerae CBMB27 + + + Methylobacterium phyllostachyos BL47 + + + Methylobacterium platani JCM 14648 + + + Methylobacterium populi BJ001 + + + Methylobacterium pseudosasicola BL36 + + + Methylobacterium salsuginis CGMCC 1.6474 + + + Methylobacterium tarhaniae DSM 25844 + + - Methylobacterium variabile DSM 16961 + + - Methyloceanibacter caenitepidi Gela4 + - - Methylopila sp. 73B + + - Methylopila sp. M107 + + - Betaproteobacteria Methylobacillus flagellatus KT + + + Methylobacillus glycogenes JCM 2850 + + + Methylobacillus rhizosphaerae Ca-68 + + + Methylotenera sp. 1P/1 + + - Methylotenera sp. 73s + + + Methylotenera mobilis JLW8 + + - Methylotenera versatilis 301 + + - Methylotenera versatilis 79 + + + Methylophilus methylotrophus DSM 46235 + + + Methylophilus rhizosphaerae CBMB127 + + + Methylophilus sp. 1 + + + Methylophilus sp. 42 + + + Methyloversatilis discipulorum RZ94 - - - Methyloversatilis thermotolerans NVD - - - Methyloversatilis universalis FAM5 - - - Methylovorus glucosetrophus SIP3-4 + + + Methylovorus sp. MP688 + + + Methylibium petroleiphilum PM1 - - - Gammaproteobacteria Methylophaga aminisulfidivorans MP + ++ + Methylophaga lonarensis MPL + + + Methylophaga nitratireducens JAM1 + + + Methylophaga frappieri JAM7 + + + Methylophaga sulfidovorans DSM 11578 + + + Methylophaga thiooxydans DMS010 + + + </p>