Identifying Disease Genes Worksheet

Identifying Disease Genes Worksheet

<p> Identifying Disease Genes Worksheet </p><p>In this activity, you will be given a nucleotide sequence found in real human DNA that is associated with a genetic disease when mutated. Your task is to compare the sequence you are given with known genes in the National Center for Biological Information (NCBI) website, using their Basic Logical Alignment Search Tool (BLAST) program. </p><p>You only need to print out the question sheet to turn in and attach the map of the chromosome. </p><p>Directions:</p><p>1) Go to the NCBI website, found at http://www.ncbi.nlm.nih.gov/, and click on the word “BLAST”, located on to the right.</p><p>2) Look under Basic Blast and click on the link for “Nucleotide BLAST”. CAREFULLY type in the exact nucleotide sequence in the large empty FASTA sequence box.</p><p>3) Now click on the “BLAST!” button.</p><p>4) On the webpage of your BLAST results, scroll down to the section with the horizontal colored lines, and carefully position your mouse on the “0” found below the word “Query”. Now slowly move your mouse below to the start of the first colored line. You should see the phrase “Mouse-over to show defline and scores, click to show alignments” in the white box change to indicate the name of the gene associated with the nucleotide sequence you typed in. </p><p>5) Slowly continue moving the mouse down each of the next 5 successive colored lines, taking note what appears in the white box. What seems to be the name of your human disease? You can scroll further down to see boxes that identify the disease and sequences associated with the gene that is responsible for the disease. The name of the gene and the chromosome it is located on is also given. Identify what chromosome it is on and answer question below. </p><p>6) Continue on to the section on Descriptions. Find the first entry that identifies the gene sequence that belongs to Homo sapiens. Click on that. Scroll down until you find the entry that describes the disease as belonging to Homo sapiens and click on “Graphics” or “Map Viewer”. It will bring up a map of the chromosome that you can print out.. </p><p>7) Go back and click on “Gen Bank” and it will give you the function of the protein that the gene codes for and the problems the mutation cause for the recipient. Describe this below in questions 3 and 5. You will have to Google for any more information about the disease. Some of the information may be hard for you to understand but at least you can get an idea of the complexity of our molecular selves.</p><p>Sequences are given on the next page. YOUR SEQUENCE (Look for your sequence below based on your last name.)</p><p>Last Name A-H:</p><p>ATGCTCACATTCATGGCCTCTGACAGCGAGGAAGAAGTGTGTGATG AGCGGACGTCCCTAATGTCGGCCGAGAGCCCCACGCCGCGCTCCTG CCAGGAGGGCAGGCA GGGCCCAGAGGATGGAG</p><p>Last Name I-P:</p><p>ATG CCG CCC AAA ACC CCC CGA AAA ACG GCC GCC ACC GCC GCC GCT GCC GCC GCG GAA CCC CCG GCA CCG CCG CCG CCG CCC CCT CCT GAG GAG GAC CCA GAG CAG GAC AGC GGC CCG GAG GAC</p><p>Last Name Q-Z:</p><p>ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGT CCTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC AGCAGCAGCAGCAGCAGCAGCAGCAACAGCCGCC Identifying Disease Genes Worksheet Name ______</p><p>1) Name the genetic disease associated with the nucleotide sequence you were given.</p><p>2) Name the gene (Gene ID) that is responsible for your disorder. This is probably the name of the protein the gene codes for.</p><p>3) What is the function of the protein the gene codes for? </p><p>4) Identify the chromosome(s) on which this gene is most likely to be found.</p><p>5) What are the symptoms of the disease?</p><p>6) Print out the chromosome location diagram and attach it to this paper. </p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    3 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us