<p>Supplementary Fig. S1 a Quantitative RT-PCR analysis of gene expression of AtXXT2, TmXXT2,</p><p>TmXXT5 and SlXXT2 expressed in the xxt1/xxt2/xxt5 triple knockout mutants (xxt1/2/5 k.o.) of Arabidopsis. b Quantitative RT-PCR analysis of gene expression of TmXXT2, TmXXT5 and SlXXT2 expressed in the xxt1/xxt2 double knockout mutants (xxt1/2 k.o.) of Arabidopsis. </p><p>Expression was normalized based on an internal control (PTB, Polypyrimidine Tract Binding protein) and comparison to a standard curve of the corresponding genes in a plasmid. Two independent lines are shown for each construct. Error bars indicate standard deviation, n=3 a</p><p> b</p><p>1 AtWT.1 xxt1/2/5 AtXXT2.1 AtXXT2.2 TmXXT2.1 TmXXT2.2 TmXXT5.1 TmXXT5.2 SlXXT2.1 SlXXT2.2</p><p>Supplementary Fig. S2 a Representative 4-week-old Arabidopsis plants of Arabidopsis thaliana WT (AtWT), xxt1/xxt2/xxt5 triple knock-out (k.o.) line (xxt1/2/5 k.o.), transgenic lines of triple xxt1/2/5 k.o. expressing AtXXT2, TmXXT2, TmXXT5, SlXXT2 genes. Two independent lines are shown for each construct. b Plant phenotype. Average leaf length of the Arabidopsis thaliana WT (AtWT), xxt1/xxt2/xxt5 triple k.o. line (xxt1/2/5 k.o.), transgenic lines of triple xxt1/2/5 k.o. expressing AtXXT2, TmXXT2, TmXXT5, SlXXT2 genes, at 4 weeks with two independent lines for each construct. Error bars indicate standard deviation (n =5 leaves). a & b indicate statistical significance from the WT (WT, a:p ≤ 0.01, b: p≤0.001) a</p><p> b</p><p>2 Supplementary Fig. S3 a Representative 4-week-old Arabidopsis plants of Arabidopsis thaliana WT (AtWT), xxt1/xxt2 double knock-out (k.o.) line (xxt1/2 k.o.), transgenic lines of double xxt1/2 k.o. expressing TmXXT2, TmXXT5, SlXXT2 genes. Two independent lines are shown for each construct. b Average leaf length of the Arabidopsis thaliana wildtype (AtWT), xxt1/xxt2 double k.o. line (xxt1/2 k.o.), transgenic lines of triple xxt1/2 k.o. expressing TmXXT2, TmXXT5, SlXXT2 genes, at 4 weeks with two independent lines for each construct. Error bars indicate sd (n = 5 leaves). Statistical significance compared to WT is indicated (WT, a: p ≤ 0.01, b: p≤0.001) </p><p> a</p><p>TmXXT5.1 TmXXT5.2 SlXXT2.1 SlXXT2.2 AtWT.1 xxt1/2/5 TmXXT2.1 TmXXT2.2</p><p> b</p><p>3 Supplementary Fig. S4 Rna Seq expression data of unopened flower buds, 1cm fruit, 2cm fruit, 3cm fruit, mature green fruit, roots and leaves of tomato (Solanum lycopersicum) cultivar Heinz (( http://ted.bti.cornell.edu )</p><p> a</p><p>4 Supplementary Table. S1 a Quantification of XyG oligosaccharide profiles as determined by HPAEC- PAD analysis (Fig. 4) derived from leaf tissue of Arabidopsis WT (AtWT), and transgenic lines of xxt1/2/5 k.o expressing SlXXT2, TmXXT2 and AtXXT2. b Quantification of XyG oligosaccharide profiles as determined by HPAEC-PAD analysis (Fig. 4) derived from leaf tissue of Arabidopsis WT (AtWT), and transgenic lines of xxt1/2 k.o expressing SlXXT2, TmXXT2 and AtXXT2. Quantities are in µg/mg wall material, n=3. a</p><p>XXG XXGG XXXG XXFG XXLG/XLXG XLFG TOTAL XyG</p><p>SlXXT2 0.10±0.03 0.021±0.00 0.20±0.01 0.22±0.01 0.18±0.01 0.022±0.00 0.75±0.04</p><p>TmXXT2 0.10±0.01 0.021±0.00 0.21±0.01 0.23±0.01 0.18±0.01 0.022±0.00 0.76±0.02</p><p>AtXXT2 0.11±0.02 0.022±0.00 0.20±0.01 0.22±0.01 0.18±0.01 0.022±0.00 0.75 0.01</p><p>AtWT 0.07±0.01 0.017±0.00 0.22±0.01 0.26±0.01 0.20±0.01 0.024±0.00 0.80±0.02 b</p><p>XXG XXGG XXXG XXFG XXLG/XLXG XLFG TOTAL XyG</p><p>SlXXT2 0.11±0.0 0.02± 0.00 0.20±0.01 0.25±0.01 0.19±0.01 0.02±0.00 0.80±0.02</p><p>TmXXT2 0.10±0.01 0.02±0.00 0.21±0.01 025±0.01 0.18±0.01 0.02±0.00 0.79±0.02</p><p>AtWT 0.07±0.01 0.02±0.00 0.22±0.00 0.27±0.01 0.21±0.01 0.02±0.00 0.82±0.01</p><p>5 6 Supplementary Table S2 Primers</p><p>AtXXT2-F GGGGACAAGTTTGTACAAAAAAGCAGGCT ATGATTGAGAGGTGTTTAGGAG</p><p>ATXXT2-R GGGGACCACTTTGTACAAGAAAGCTGGGT TCAAACTTGATTGGTTTGTACC</p><p>TmXXT2-F GGGGACAAGTTTGTACAAAAAAGCAGGCT ATGATAGAGAGGTGTTTAGGAG</p><p>TmXXT2-R GGGGACCACTTTGTACAAGAAAGCTGGGT TTAACCAGAGGCTACCTTAAC</p><p>TmXXT5-F GGGGACAAGTTTGTACAAAAAAGCAGGCT ATGGGTCAGGAGATTTTCAC</p><p>TmXXT5-R GGGGACCACTTTGTACAAGAAAGCTGGGT CTATGATCCAACTTTTCCAACG</p><p>SlXXT2-F GGGGACAAGTTTGTACAAAAAAGCAGGCT ATGTTAGATCGATTTCTGAGTG</p><p>SlXXT2-R GGGGACCACTTTGTACAAGAAAGCTGGGT TCAAGAAGATGGTACCTTGA</p><p>RT-QPCR ATXXT2-F ACCCGACCCGAATAAACCTTAC</p><p>AtXXT2-R CCGAACCAGTCACCAAAAGAAC</p><p>TmXXT2-F GTTTTGGGCTAAGCTCCCTTTG</p><p>TmXXT2-R TCACTGTCCATCCACCAAAGG</p><p>TmXXT5-F CTTTCGAAGCCGACGATCAATC</p><p>TmXXT5-R TCGACCAATCCTTCCCAGAAAC</p><p>SlXXT2-F TGCACGGTTACTGGGGAATTC</p><p>SlXXT2-R AAGGCTTGCAACCCACAAAG</p><p>AtPTB-F GATGAGCCGAACCGTATTCTCT </p><p>AtPTB-R AGTGACGAGCTTCTCGACAAAT </p><p>7</p>