<p>Midlands state University Biological Sciences Department Advanced Molecular Genetics (HBIO 423) Practicals</p><p>Lecturer :Muteveri M PRACTICAL 1: PREPARATION OF SOLUTIONS</p><p>A. Calculation of Molar, % and X solutions</p><p>1. A molar solution is one in which 1 litre of solution contains the number of grams equal to its molecular weight.</p><p>Example: To make up 100ml of a 5M NaCl = 58,456 (Mw of NaCl) g /mol x5 moles /litre X 0.1 litre =29.29 g in 100ml of solution</p><p>2. Per cent solutions Percentage (w/v) = weight (g) in 100nl of solution</p><p>Per cent (v/v) = volume (ml) in 100ml of solution</p><p>Example; To make a 0.7% solution of agarose in TBE buffer, weigh 0.7g of agarose and bring up the volume to 100ml with TBE buffer.</p><p>3. X solutions Many enzymes and buffers are prepared as concentrated solutions e.g. 5X or 10X (five or ten times the concentration of the working solution) and are then diluted such that the final concentration is 1X.</p><p>Example: To make 1 litre of 1 X electrophoresis running buffer, one would need 100mls of a 10 X buffer stock in a final volume of 1000 ml.</p><p>B. Preparation of working solutions from concentrated stock solutions</p><p>Many buffers in molecular biology require the same components but often in varying concentrations.to avoid having to make every buffer from scratch, it is useful to prepare several concentrated stock solutions and then dilute as needed</p><p>Example: To make 100 ml TE (10 mM Tris, 1 mM EDTA), combine 1 ml of a 1M Tris stock solution with 0.2ml of 0.5M EDTA and add 98.8 ml of sterile water</p><p>The following is useful when calculating amounts of stock solution needed</p><p>C1X V1= C2 X V2</p><p>C1= initial concentration, or concentration of stock</p><p>V1= initial volume, or amount of stock solution needed</p><p>C2 =Final concentration, or concentration of desired solution</p><p>V2= Final volume or volume of desired solution C. Steps in solution preparation</p><p>Refer to a laboratory manual for any specific instructions on the preparation of the particular solution and the bottle label for any specific precautions in handling the chemical.</p><p>Weigh out the desired amount of the chemical(s). Use an analytical balance if the amount is less than 0.1g. Place the chemical into the appropriate size beaker with a stir bar. Add less than the required amount of water. When the chemical is dissolved, transfer to a graduated cylinder and the required amount of water to achieve the final volume. Autoclave if possible at 121C for 20 minutes. Some solutions however cannot be autoclaved for example SDS. These should be filter sterilized using a 0.22 or 0.45μM filters.</p><p>D. Glassware and plastic ware </p><p>Glass and plastic ware used for molecular biology must be scrupulously clean. Dirty test tubes, bacterial contamination and traces of detergent can inhibit reactions or degrade nucleic acids. Glassware should be rinsed with distilled water and autoclaved or baked at 150C for 1 hour. For experiments with RNA, glassware and solutions must be treated with DEPC to inhibit RNAses, which can be resistant to autoclaving</p><p>E. Conversions</p><p>Table1. Common conversions in molecular biology (metric weights)</p><p>Unit Conversion factor Unit Kilogram (Kg) X103 Grams (g) Gram (g) ‘’ Milligram (mg) Milligram (mg) ‘’ Microgram (μg) Microgram μg ‘’ Nanogram (ng) Nanogram (ng) ‘’ Picogram (pg) Pictogram (pg) ‘’ Femtogram NB To convert from right to leave, the factor becomes (-) Table 2. Common conversions in molecular biology (liquids Unit Conversion factor Unit Litre X 103 Millilitre Millilitre , Microliter Microliter , Nano litre Nano litre , Pico litre NB To convert from right to leave, the factor becomes (-)</p><p>GENERAL SOLUTIONS AND REAGENTS</p><p>Luria Broth (1 litre)</p><p>10g Tryptone 5g Yeast extract agar 5g NaCl </p><p>Dissolve in 1 litre distilled water and autoclave.</p><p>For LB agar, add 15g/l agar.</p><p>Ampicillin stock 100mg/ml in water. Filter sterilise and store at 4C.Dilute stock accordingly to make a working final concentration of 100ug /ml</p><p>Tris-HCL (1M) Dissolve 121g of Trizma base, in 80 ml 0f water. Adjust pH to the required level with HCL, make up to 100ml with water.</p><p>10x TE 100mM Tris- HCl 10mM EDTA</p><p>For 500ml dissolve 6g Tris and 1.86gEDTA in 400ml of water. Adjust pH to 7.5 with concentrated HCL. Make the volume up to 500ml.</p><p>70 % ethanol 70 ml absolute ethanol 30ml dH20</p><p>Loading buffer 0.25% bromophenol blue 0.25% Xylene cyanol 30% glycerol</p><p>NaCl (5M)-500ml NaOH (5M)-500ml 10 % SDS</p><p>EDTA stock 0.5M</p><p>5X TBE </p><p>54g Tris base 27.5g boric acid 20ml of 0.5 EDTA stock</p><p>GTE (Glucose, Tris-HCl, EDTA)</p><p>25mm Tris HCl, pH8 10mM EDTA 50mM glucose</p><p>Autoclave and store at 4°C</p><p>NaOH/SDS</p><p>0.2M NaOH 1% SDS</p><p>Exercise 1</p><p>Do the following calculations for the preparation of </p><p>1. 10X Phosphate Buffered Saline (PBS) pH 7.4 (100ml)</p><p>1.4M NaCl MW 58.44 g/mol 27 mM KCL MW 74.56 g/mol 100 mM Na2 HPO4 MW= 141 g/mol 18mM KH2 PO4 MW 136.09 gmol</p><p>2. a) 250 ml of 5mMTris-HCl pH 8.0 from a 1M stock b) from a powder MW 121.14gmol</p><p>3. Equilibration buffer: One litre 1X PBS pH 7.4,150 mM NaCl using 10X PBS and 3M NaCl stock</p><p>4. How would you make 1 litre of 1X PBS pH 7.4,150mM NaCl if you have a 5X PBS stock and NaCl (Mw 58.44g/mol) in powder form? Exercise 2</p><p>The solutions below are required for the DNA extraction experiment. Describe how you would prepare the solutions</p><p>1. 200ml of 2X CTAB with the following recipe: </p><p>2% CTAB (Cetylmethylamonium bromide/hexadecyltrimethylammonium bromide 100mM Tris-Cl pH 8 20mM EDTA 1.4M NaCl 2% PVP-Polyvinyl pyrolidone 0.6% Sodium sulphite</p><p>2. TE (10 mM Tris, 1mM EDTA) pH 8 (100ml) i) from pure solid components ii) from a 10X stock iii) From 1M Tris and 0.5M EDTA </p><p>10mM Tris –Cl 1mM EDTA</p><p>3. Proteinase K (20mg/ml) from a powder (2ml)</p><p>4. RNAse A (10mg/ml) from a powder of RNAse A (5ml)</p><p>5. Chloroform -Isoamyl Alcohol 24:1 v/v</p><p>6. 0.5M EDTA from a powder of EDTA (100ml)</p><p>7. Tris-Cl pH 7.4 200ml from a pure solid of Tris</p><p>8. 10X TBE :</p><p>108 g Tris Base 55 g Boric acid 9.2 g EDTA</p><p>How would you make 2 litres of a 1X electrophoresis buffer from the 10X stock? </p><p>9. 50 ml of 70 % ethanol from a 100 % stock 10. 10 % w/v SDS-sodium dodecyl sulphate (100ml)</p><p>11. Electrophoresis tracking dye: 0.25% bromophenol blue 40% (w/v) sucrose in water</p><p>12. 6X Agarose Gel Loading Dye (prepare 5ml)</p><p>200 mL Glycerol 30 mL Bromophenol Blue 0.5 g Xylene Cyanol 0.5 g PRACTICAL 2: ISOLATION OF PLANT GENOMIC DNA FROM SPLIT PEAS</p><p>Introduction</p><p>The isolation of DNA from any type of cell requires the use of the same general procedure: 1.Breaking open the cell (and nuclear membrane if applicable) 2.Removing protein and other debris from the nucleic acid and 3.Final purification and precipitation</p><p>There are several ways of accomplishing this and the method chosen depends on how pure the final product must be. The process of breaking the cell is termed lysis and is usually achieved through treatment of the cell with detergents like SDS, TritoX-100 etc. Depending on the source of the starting material. Most gram-negative bacteria cells can be lysed with SDS; where as gram positive cells would require the use of the detergent plus a proteolytic enzyme. Plant cells might even require physical disruption such as grinding or blending. The next step after lysis involves the removal of proteins from the nucleic acid mixture and this can be achieved through treatment with protein digesting enzymes (proteinases) and or treatment with organic solvents such as phenol. Proteins dissolve on phenol, but DNA does not. The final stage will be the precipitation of the DNA with and alcohol based solvent</p><p>Materials</p><p>Split peas Salt Distilled water Dishwashing liquid Meat tenderizer Ethanol 96% Blender Strainer 100ml measuring cylinder 500ml beaker test tubes Method</p><p>1.To 100ml of split peas, add a pinch of salt and 200ml of cold water. Allow to stand overnight to soften.</p><p>2. Blend the mixture for 10 minutes and pour through a strainer into a beaker.</p><p>3.Add 10 ml of dishwashing liquid, mix and stand for 10 minutes</p><p>4.Pour 5 ml of mixture into a test tube</p><p>5.Add a pinch of meat tenderizer, stir gently by inverting the tube</p><p>6. Add an equal volume of 96%ethanol and watch the DNA appear</p><p>Questions to consider when writing this report</p><p>1.What role does the dishwashing liquid play in this method?</p><p>2.What compound is normally used in laboratories to fulfil this function?</p><p>3.What does the meat tenderizer replace in the standard DNA isolation procedure?</p><p>4.Why was 96% ethanol used in this practical? PRACTICAL 3: GENOMIC DNA EXTRACTION FROM SORGHUM LEAVES</p><p>1. Place leaves (0.5g) in a mortar and add liquid nitrogen (or freeze tissue in a -</p><p>80 °C freezer for 30 minutes. Allow the liquid nitrogen to </p><p> subside and grind up the leaves using a </p><p> pestle until a fine powder is obtained. Transfer the powder to 2ml eppendorf tubes</p><p>2. Add 1ml of warm 2X CTAB (with 0.1% - β-Mercaptoethanol NB add just before </p><p>Use) and place the tubes on a </p><p>65°C heating block/water bath for 1 hour. Beware of popping caps</p><p>3. Centrifuge for 5 minutes at 1300 rpm in a micro centrifuge</p><p>4. Transfer the supernatant to fresh micro tubes</p><p>5. Add x ųl of Proteinase K (20mg/ml) to a final concentration of 100 ųg/ml and incubate at 37°C for 30 minutes</p><p>6. Add an equal volume of Chloroform-Isoamyl alcohol 24:1 (CIA) and invert tubes Several times</p><p>7. Centrifuge for 10 minutes at 13000 rpm</p><p>8. Transfer the supernatant to fresh micro tubes</p><p>9. Add x ųl of RNAse A (10mg/ml) to a final concentration of 100 ųg /ml and incubate for 30-60 minutes</p><p>10. Add equal volumes of CIA (24:1) and invert tube several times</p><p>11. Centrifuge for 10 minutes</p><p>12. Transfer the supernatant to fresh micro tubes</p><p>13. Add 2/3 of ice-cold Isopropanol</p><p>14. Invert tube 2-3 times and incubate at -20°C for 30 minutes or more (overnight) 15. Centrifuge for 20 minutes</p><p>16. Very carefully pour off the supernatant</p><p>17. Wash pellet in 70% ethanol by vortexing hard to remove salts.</p><p>18. Centrifuge for 30 minutes</p><p>19. Carefully pour off the supernatant </p><p>20. Allow the DNA pellet to air dry at room temperature or at 37 °C</p><p>21. Resuspend the pellet in 100-ųl of 1X TE buffer pH 8 </p><p>22. Allow to resuspend on workbench for 3 hours or at 4 °C overnight.</p><p>23. Quantify the DNA using a Nano drop, electrophoresis on 1% agarose or by using a spectrophotometer </p><p>24. Determine the purity of the DNA</p><p>25. Store DNA at 4°C or -20°C for long-term storage PRACTICAL 4: QUANTITATION AND PURITY ASSAY OF DNA a) Spectrophotometry</p><p>Introduction</p><p>Experiments requiring the manipulation of DNA in most cases require its accurate quantitation to ensure optimal and reproducible results. DNA can be quantified using spectrophotometric techniques. The nitrogenous bases of DNA can absorb ultraviolet light (UV) at a wavelength of 260 nm. The amount of light absorbed at this wavelength is proportional to the concentration of the nucleic acid. In this technique, one can use the information that 1 Absorbance unit of DNA at 260nm is equivalent to </p><p>50ug of DNA/ml.</p><p>1 Absorbance unit@ 260 =50ug/ml of DNA</p><p>Quantitation of DNA allows use of specified quantities in experiments, thus improving efficiency as well as economizing the nucleic acid. </p><p>The purity of DNA also important for further work involving nucleic acids because impurities can adversely affect the quality of results obtained. DNA purity can be checked using spectroscopy. Calculating the ratio A260/A280 is used to give an estimate of protein contamination. If the ratio is close to 1.8, the DNA is acceptably pure. In this practical you will ascertain the purity of DNA that you isolated from previous materials. A Nanodrop is a ‘state of the art’ instrument that can be used to determine the concentration and purity of DNA in and instant using very small amounts of DNA samples.</p><p>Quantitation</p><p>1. Pipette 5 ul of bacterial genomic DNA into 995ul of TE buffer</p><p>2. Read the absorbance at 260 nm and 280nm against a TE buffer blank</p><p>3. Repeat the above procedure with plant genomic DNA</p><p>4. Calculate the ratios and concentration and determine whether the DNA is pure </p><p> or not. Remember to take into account the dilution factor</p><p>Purity checks</p><p>Use the A260/A280 ratio to ascertain the purity of the DNA.</p><p>Question to consider</p><p>Assume that you successfully isolated genomic DNA from sorghum leaves and have resuspended the DNA in 50 ul of TE buffer. You dilute 20 ul of the purified DNA into a total volume of 1000 ul of distilled water and measure the absorbance of the diluted sample at 260nm and 280nm and obtain the following readings.</p><p>A260 = 0.550 A280 = 0.324</p><p> a) What is the concentration of the 50-ul preparation of DNA you obtained</p><p> b) How much total DNA was purified in the experiment</p><p> c) What is the A260/A280 ratio of the purified DNA and comment on the purity </p><p> of the DNA</p><p> d) Calculate the total remaining amount of DNA b) Electrophoresis</p><p>Introduction</p><p>DNA molecules, like proteins and many other biological compounds carry an electric charge. DNA is negatively charged owing to the PO4 group. Consequently, when </p><p>DNA molecules are placed on an electric field, they will migrate towards the positive pole. The rate of migration of a molecule depends on its shape and charge. </p><p>Electrophoresis is performed in a gel, which is usually made of agarose. The agarose provides a network of pores through which the DNA molecules must migrate to reach the positive electrode. The smaller the DNA molecule, the faster it can migrate through the gel. The composition of the gel determines the sizes of molecules that can be separated. The higher the percentage of the gel, the smaller the pores of the gel. </p><p>Electrophoresis is another technique that can be used to ascertain the purity of nucleic acids. In addition it also allows one to determine the size and integrity of the DNA</p><p>Preparation of a 1% agarose gel</p><p>1. Weigh the appropriate amount of agarose into a 50ml flask and add 1XTBE</p><p>2. Heat while stirring until agarose is dissolved and solution is clear.</p><p>3. Allow the gel solution to cool to 55C and add ethidium bromide: care ethiduim </p><p> bromide is dangerous so you must always wear gloves</p><p>4. Prepare gel casting apparatus and place comb.</p><p>5. Pour the gel into the casting apparatus and allow it solidify for 20 minutes. 6. Transfer the gel to the electrophoresis tank and cover it with electrophoresis buffer</p><p>7. Gently remove the comb from the gel.</p><p>8. Pipette 8 ul of sample into a clean eppendorf tube and add 2 ul of DNA loading </p><p> dye</p><p>9. Load the sample onto the gel and run at 100V for 1 hr.</p><p>10. View the gel under UV light.</p><p>11. Determine the purity and integrity of the DNA PRACTICAL 5: THE POLYMERASE CHAIN REACTION (PCR)</p><p>Introduction </p><p>The polymerase chain reaction (PCR) involves the amplification of a specific segment of nucleic acid from very small amounts of DNA into a larger amount. It is a very quick, easy and automated technique. Larger amounts of DNA mean that more accurate and reliable results for later downstream techniques can be obtained. The technique was developed by a Nobel laureate biochemist Kary Mullis in 1984 and is based on the discovery of the biological activity at high temperatures of DNA polymerases found in thermophiles (bacteria that live in hot springs).</p><p>A thermophilic DNA polymerase called Taq polymerase is named after Thermus </p><p>Aquaticus, the bacteria from which it is derived. PCR is a very powerful technique that has found use in a wide range of applications namely a) diagnosis of genetic disease b) identification of contaminating microorganisms in food and c) examination of biological evidence in forensic cases just to name a few.</p><p>There are three key requirements necessary to perform PCR and these are</p><p>1. The target sample-The biological sample to be amplified</p><p>2. A primer- short strands of DNA that adhere to target segments</p><p>3. Taq polymerase –The enzyme that replicates DNA</p><p>4. Nucleotides (dNTPs) The building blocks that are used to synthesize new DNA</p><p>The PCR involves three major steps, which are repeated over and over again. These steps are denaturation; annealing and extension .PCR is so efficient because it multiplies DNA samples exponentially because each new segment acts as a template for new ones. It is important to be careful to avoid contamination as this may result in false positive results. A negative control is always in cooperated to check for contamination with other DNA templates.</p><p>PCR optimization</p><p>1. Annealing temperature. The annealing temperature for the two primers used can be empirically determined using the formula</p><p>Tm (°C) =4 (G+C) +2 (A+T)</p><p>2. Magnesium concentration ( Mg2+) The magnesium concentration has to be about </p><p>1.5mM-3 mM. Too low or too high concentration will cause the polymerase to make more mistakes</p><p>3. Primer design Both primers should have approximately the same Tm so that they both anneal at the same temperature. Primers with ends that anneal to each other form primer dimers and this will prevent the formation of PCR products</p><p>Procedure</p><p>1. Determine the missing components in the reaction set up below.</p><p>Component Volume Final concentration 10x buffer 2.5 1x MgCl2 25mM 1.5mM dNTPs 5mM Primers 5uM 0.2 uM Taq polymerase 5U/ul 1 DNA 50 ng /ul 2</p><p>H2O - Total volume 25 ul</p><p>Fig. 1 Typical reaction components of a PCR 2. Set up the PCR reaction as above and programme the PCR conditions as follows:</p><p>Step 1 Initial Denaturation 94°C for 2 minutes (1 cycle)</p><p>Step 2 Denaturation 94°C for 30 sec</p><p>Step 3 Annealing 58°C for 30 sec</p><p>Step 4 Extension 72°C for 1 minute (length of step depends on the size of PCR </p><p> product</p><p>Step 5 Final extension 72°C for 10 minutes</p><p>3. While the PCR is running, prepare an agarose gel. Place the gel in 1X TBE buffer</p><p>4. Once the PCR cycles is complete, load the gel by first mixing together the loading </p><p> dye and the PCR product as follows?</p><p>1ul loading buffer + 4 ul of PCR amplified DNA</p><p>5ul of molecular weight marker</p><p>5. Separate the fragments by running the gel at 100V for 1hr</p><p>6. Visualize the gel under UV light and take a photograph.</p><p>7. Determine the size of your amplified product.</p><p>PRACTICAL 5: Bioinformatics</p><p>Introduction a) Primer Design-Exercise</p><p>The specificity of PCR depends on the primers. The following factors are considered when designing primers: Seven Rules</p><p>1. Primers should be 17-30 nucleotides long.</p><p>2. The G: C content should be at least 50%</p><p>3. Avoid strings of a nucleotide (more than 3-4)</p><p>4. Primers should have a G or a C at the 3’ end</p><p>5. Tm should be between 55-65 C Tm =2(A+T) + 4(G+C)</p><p>6. The 3’ ends of a primer should not be complementary or primer dimers form</p><p>7. Avoid primer self complementation (prevent hairpins forming)</p><p>A special case in primer design (for PCR) is when you need to add extra bases to a primer, for example a restriction site. Typically one might design a primer that contains 18 nt perfectly matching the template, plus 6-nt representing the restriction site, and then about 2-nt more to assist in the restriction digestion (some enzymes need to "sit" upon a sequence larger than the restriction site itself;</p><p>Procedure for primer design Primer design can be done manually or using computer software. Each method has its own advantages and disadvantages</p><p>Software</p><p>The most important thing is to investigate the related papers in advance as many as possible. Most primer sequences are already reported in papers and can just be used. If the primers cannot be found then the following procedure is used: 1. Find full sequence of gene to be to amplified 2. Copy it to the Oligo software. 3. Determine the product size. 4. The Oligo program finds the appropriate primers automatically.</p><p>Manual method- Method more tedious</p><p>Example S. vulgare SoAc1 mRNA: GenBank: X79378.1</p><p>S.vulgare SoAc1 mRNA GenBank: X79378.1 GenBank Graphics >gi|499011|emb|X79378.1| S.vulgare SoAc1 mRNA</p><p>TCTCCAACGCCCCTCCTCGCCGCGGATCCCCCGCTACTCCGGTAGAAAATGGCTGACGCCGAGGATATC C AGCCCCTCGTCTGCGACAATGGAACCGGTATGGTCAAGGCTGGGTTCGCTGGAGATGACGCCCCCAGGG C CGTCTTCCCCAGCATTGTCGGCCGGCCGCGCCACACCGGTGTCATGGTCGGGATGGGGCAGAAGGACGC C TACGTTGGTGACGAGGCGCAGTCCAAGAGGGGTATCCTGACCCTCAAGTACCCCATCGAGCACGGAATC G TCAGCAACTGGGACGATATGGAGAAGATCTGGCATCACACCTTCTACAACGAGCTCCGTGTGGCTCCCG A GGAGCACCCCGTCCTCCTCACTGAGGCGCCCCTGAACCCCAAGGCTAACCGTGAGAAGATGACCCAGAT C ATGTTCGAGACCTTCAACACCCCCGCCATGTACGTCGCCATCCAGGCCGTCCTCTCTCTGTATGCCAGC G GTCGTACCACAGGTATCGTGCTCGACTCGGGAGATGGTGTCAGCCACACTGTCCCCATCTACGAAGGGT A CGCCCTCCCCCACGCCATCCTGCGTCTCGACCTCGCTGGCCGCGACCTTACCGACTACCTCATGAAGAT C CTGACTGAGCGCGGCTACTCCTTCACCACCACTGCTGAGCGGGAAATTGTCAGGGACATGAAGGAGAAG C TCGCCTACATTGCCCTGGACTACGACCAGGAGATGGAGACTGCCAAGACCAGCTCTTCCGTGGAGAAGA G CTACGAGCTTCCTGATGGACAGGTCATCACCATTGCGGCGGACCGATTCCGCTGCCCTGAGGTCCTCTT C CAGCCATCCTTCATTGGGATGGAAGCTGCTGGCATTCACGAGACTACCTACAACTCCATCATGAAGTGC G ACGTGGATATTAGGAAGGATCTATATGGCAACATCGTCCTCTCTGGTGGTACCACTATGTTCCCTGGGA T TGCTGACAGGATGAGGCAAGGAAATCACTGCCTTGCTCCTAGCAGCATGAAGATCAAGGTGGTTGCTCC T CCAGAAAGGAAGTACAGTGTCTGGATTGGAGGATCCATCTTGGCATCTCTCAGCACATTCCAGCAGATG T GGATTGCCAAGGCTGAGTACGACGAGTCTGGCCCATCCATTGTGCACAGGAAATGCTTCTAATTCTTTC C GCCCAAGAAATGCAAGCCGAGAGAGCCATTATCACCAGCCTCCTGCCCTGTTTCTTTCTCTTTTTGTTG C TGTTTCTTCATTAGCATGAACAAAGTTTTCTGCCGGTCTATCGGCCACCGCTTTCTTCTATTCATCAAG A CTGTAATATCTATTGCTACCTATGCTTCTCACTTGATTTTGGACACATATGTTCGGTCTATTCAATTTT A ATGAGTCCTGATGAGGCTACTAGCATATAAAAAACGGCCGCAATT</p><p> b) Exploring genome sequence databases -NCBI, Phytozome,TAIR, ExpaSy</p>