
<p> Identifying Disease Genes Worksheet </p><p>In this activity, you will be given a nucleotide sequence found in real human DNA that is associated with a genetic disease when mutated. Your task is to compare the sequence you are given with known genes in the National Center for Biological Information (NCBI) website, using their Basic Logical Alignment Search Tool (BLAST) program. </p><p>You only need to print out the question sheet to turn in and attach the map of the chromosome. </p><p>Directions:</p><p>1) Google NCBI to go to the site found at http://www.ncbi.nlm.nih.gov/, and click on the word “BLAST”, located on to the right.</p><p>2) Look under Basic Blast and click on the link for “Nucleotide BLAST”. Scroll down to the bottom of these directions and find the sequence that corresponds to your last name initial. Cut and paste that sequence into the box. </p><p>3) Now click on the “BLAST!” button.</p><p>4) On the webpage of your BLAST results, scroll down past the section with the horizontal colored lines. These lines correspond to alignments to your sequence. Continue on to the section on Descriptions. Find the first entry that identifies a human disease. What seems to be the name of your human disease? See questions below.</p><p>5) Click on that entry and you will come to a page with a lot of information and a chromosome map containing your gene sequence. Print out the chromosome map. </p><p>6) On that page is also the name of the protein coded by that gene and also a summary of the disease associated with the gene sequence. Answer the applicable questions below. </p><p>7) You will have to Google for more information about the disease, including symptoms. Please avoid complex medical terms or look them up so you can describe in terms you understand. Some of the information may be hard for you to understand but at least you can get an idea of the complexity of our molecular selves.</p><p>YOUR SEQUENCE (Look for your sequence below based on your last name.)</p><p>Last Name A-H:</p><p>ATGCTCACATTCATGGCCTCTGACAGCGAGGAAGAAGTGTGTGATG AGCGGACGTCCCTAATGTCGGCCGAGAGCCCCACGCCGCGCTCCTG CCAGGAGGGCAGGCA GGGCCCAGAGGATGGAG</p><p>Last Name I-P:</p><p>ATG CCG CCC AAA ACC CCC CGA AAA ACG GCC GCC ACC GCC GCC GCT GCC GCC GCG GAA CCC CCG GCA CCG CCG CCG CCG CCC CCT CCT GAG GAG GAC CCA GAG CAG GAC AGC GGC CCG GAG GAC</p><p>Last Name Q-Z:</p><p>ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGT CCTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC AGCAGCAGCAGCAGCAGCAGCAGCAACAGCCGCC Print out this sheet to be turned in. </p><p>Identifying Disease Genes Worksheet Name ______</p><p>1) Name the genetic disease associated with the nucleotide sequence you were given.</p><p>2) Name the gene (Gene ID) that is responsible for your disorder. This is probably the name of the protein the gene codes for.</p><p>3) What is the function of the protein the gene codes for? </p><p>4) Identify the chromosome(s) on which this gene is most likely to be found.</p><p>5) What are the symptoms of the disease?</p><p>6) Print out the chromosome location diagram and attach it to this paper. </p>
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages2 Page
-
File Size-