Marterial and Methods

CIRCULATIONAHA/2007/714147 Version 3Material and MethodsAnimals and surgical proceduresBgn-/0-mice with a targeted deletion of bgn gene1 and male wild-type littermates (WT;C57BL/6) were compared in this study. Animals were housed under standard conditions(55% humidity, 12 h day-night rhythm, standard chow and water ad libitum). All procedures were carried out in accordance with the AAALAC guidelines and Guide for the Care andUse of Laboratory Animals (Department of Health and Human Services, National Institutes of Health, Publication No. 86-23) and were approved by the ethical and research board of the University and the county of Düsseldorf. Animals (12-16 weeks old) were randomized as indicated.Myocardial infarctionAt the age of 12 weeks WT and bgn-/0 mice were anesthetized by i.p. injection of pentobarbital (100 mg/kg). A 2 cm long PE-90 catheter attached to the hub of a needle was inserted into the trachea (a drop of 1% lidocaine was put on the tip of the tube to numb the throat and reduce the gag reflex). Mice were subjected to permanent LAD-occlusion followed by recovery for 7 or 21 days. After 7 days Evans Blue (EB) was injected prior to organ harvest via the right ventricle to demask the area at risk (AR, EB-negative). Hearts were then cut into six equal sections which were incubated with p-nitro blue tetrazolium(NBT). Infarct size (IS) was determined as the NBT-negative area. All procedures were carried out as recently described in detail2.Hemodynamic measurementsMice were anesthetized by intraperitoneal injection of thiopental (125 mg/kg), intubated, and ventilated with a respirator (Ugo Basile, type 7025). A 1.4F microconductance pressure catheter (ARIA SPR-719; Millar Instruments Inc) was positioned in the left ventricle (LV) via1 CIRCULATIONAHA/2007/714147 Version 3 the right carotid artery for continuous registration of LV pressure-volume loops in closed chest animals.3 Calibration of the recorded volume signal was obtained by hypertonic (10%) saline wash-in technique.4 All measurements were performed while ventilation was turned off momentarily. Indices of systolic and diastolic cardiac performance were derived from LV pressure-volume data obtained at steady state.Systolic function and myocardial contractility were quantified by LV end-systolic pressure(Pes), peak rate of rise in LV pressure (dP/dtmax), ejection fraction (EF), cardiac output (CO), end-systolic volume (Ves), and stroke volume (SV). Diastolic performance was measured byLV end-diastolic pressure (Ped), peak dP/dtmin, end-diastolic volume (Ved), and time constant of isovolumic pressure relaxation. During a transient preload reduction by manual vena cava occlusion we calculated the average slope of the end-diastolic pressure volume relationship (dP/dV) to determine functional LV chamber stiffness (LV stiffness, b), as described recently5. After hemodynamic characterization, lungs were removed and lung wet weight/dry weight ratios were determined. End diastolic wall stress was calculated as described previously6. Histology Formaldehyde-fixed and paraffin-embedded tissue sections were stained for matrix antigens by alkaline phosphatase anti-alkaline phosphatase (APAAP) orStreptavidin/Biotin-immunoperoxidase, techniques7,8. Primary antibodies included rabbit anti-murine LF-113 or anti-human DCN rabbit anti-murine (LF-106)9 or anti-human BGN8 and rabbit anti-rat collagen type I (Chemicon, Hofheim, Germany). For APAAP staining, mouse anti-rabbit IgG (DAKO, Hamburg, Germany) was used as a secondary antibody and a soluble complex of rabbit APAAP (Sigma-Aldrich, Munich, Germany) was added to complete the sandwich technique. The enzyme label was visualized with naphthol AS-MX- phosphate (Sigma-Aldrich) and fast red dye (Sigma-Aldrich) in the presence of levamisole2 CIRCULATIONAHA/2007/714147 Version 3(Sigma-Aldrich) in order to block endogenous alkaline phosphatase. The slides were counterstained with Mayer’s hemalaun (Sigma-Aldrich). For immunoperoxidase staining, endogenous peroxidase and avidin/biotin (Avidin/Biotin Blocking Kit, Vector Lab,Peterborough, UK) were blocked and tissue sections were incubated with biotinylated anti- rabbit IgG secondary antibody (Vector Lab) followed by Extravidin-Peroxidase (Sigma-Aldrich) and developed with diaminobenzidine (Peroxidase Substrate Kit, Vector Lab).Counterstaining was performed with methyl green. The specificity of immunostaining was tested by omitting the primary antibody or by using non-immune serum/”unspecific” IgG or by preabsorption of antisera with antigens. Movat’s pentachrome staining was performed as described previously10,11 with the modification that the saffron staining of collagen was omitted. In addition Collagen was analyzed by sirius red staining and birefringence analysis as described previously 12. All stained sections were quantified by digital image analysis13.For detection of total glycosaminoglycans cryosections were treated 4 M guanidiniumhydrochloride (10 min) containing 0.1 % TritonX100 at pH 5.8. Sections were then stained in aqueous solution of 1 % Alcian Blue 8GX for 12 h at RT followed by embedding in Aquatex. Glycosaminoglycan content was analysed by Image J freeware.Immunohistochemical analysis of CD45, biglycan and vimentinFluorescent stainings were performed on 14 µm frozen sections derived from murine hearts 7 days post MI. CD45 polyclonal rat anti mouse antibody was obtained fromPharmingen and used in a dilution of 1:50. Anti rat IgG FITC-conjugate from goat(1:100, Santa Cruz) was used as a secondary antibody to CD45. Biglycan was stained by rabbit anti rat biglycan antibody (1:500, LF 106, Larry Fischer). Vimentin as marker for fibroblasts was detected using polyclonal rabbit anti mouse vimentin (1:100, Novus3 CIRCULATIONAHA/2007/714147 Version 3Biologicals). Anti rabbit IgG F(ab`)2 fragment Cy3-conjugate from sheep (1:200,SIGMA) was used as a secondary antibody to detect biglycan and vimentin. Nuclei were stained with DAPI.Histological assessment of MMP-2, MMP-8, MMP-9, MMP-13, TIMP-1, TIMP-2, TIMP-4Immunohistochemistry was carried out using primary antibodies (MMP-2, MMP-9, TIMP-1,TIMP-2, TIMP-4: Chemicon International, Ltd., UK; MMP-8: Santa Cruz Biotechnology, Inc.,Heidelberg, Germany; MMP-13: Dianova, Hamburg, Germany) followed by the DAKOEnvision HRP technique (DAKO, Glostrup, Denmark). All stained sections were quantified by digital image analysis14.In situ zymographyDQ-Gelatin (Invitrogen) was diluted in 1% UGT-agarose (Sigma) in phosphate buffered saline pH 7.45 at 60 °C and cooled to 37°C. Subsequently, DQ-Gelatin was applied to the unfixed frozen sections (14 µm) of the hearts. The gel was allowed to solidify at4°C in the dark before the sections were incubated in a humid chamber for 72 hours at37°C. As negative controls sections were incubated with different MMP-inhibitors such as 10 µmol/L TIMP-1 or 10 mmol/L 1.10-phenanthroline which inhibited the cleavage ofDQ-gelatin (data not shown). Nuclei were stained with DAPI (1µg/ml). mRNA-ExpressionHearts were rinsed with ice cold PBS, cut into slices and LV tissue was dissected and processed for mRNA isolation using RNeasy Total RNA Kits (Qiagen, Hilden;Germany). For real-time RT-PCR the RNA concentration was determined via photometric measurement at 260/280 nm. Aliquots of total RNA (100 ng) were applied for cDNA-synthesis using SuperscriptIII First-Strand synthesis system for RT-PCR4 CIRCULATIONAHA/2007/714147 Version 3(Invitrogen, Karlsruhe, Germany). The following primer pairs were used: bgn, forward5’-3’ CAGGAACATTGACCATG, reverse 5’-3’ GAAAGGACACATGGCACTGAAG; dcn, forward 5’-3’ CCTACCGATGCCAGTGTCATC, reverse 5’-3’TGGTGTCGGGTGGAAAATCC; collagen type 1, forward 5’-3’CCAAGGGTAACAGTGGTGAACCT, reverse 5’-3’ GGCTCCTCGTTTTCCTTCTTC; collagen type 3, forward 5’-3’ CAATGTAAAGAAGTCTCTGAAGCTGATG, reverse, 5’-3’ CAAAGACTGTCTTGCTCCATTCC; 18 S rRNA, forward 5’-3’ACCTGGTTGATCCTGCCAGTAG, reverse 5’-3’ TTAATGAGCCATTCGCAGTTTC.Enzymes involved in ECM-crosslinking: procollagen-prolyl-4-hydroxylase (P4HA3), forward 5’-3’ CGACTTGACCAGATTCTATGAC, reverse 5’-3’GAAGGCAAGTAGAGGATTCAC; procollagen-lysyl-hydroxylase 2 (PLOD2), forward5’-3’ AGTGGCAATTAATGGAAATGGG, reverse 5’-3’ CTTGGGAGGGACATCTACTG; procollagen-lysyl-hydroxylase 1 (PLOD1), forward 5’-3’GAGCCTTGGATGAAGTTGTG, , reverse 5’-3’ TAGTTGCCCAGGTAGTTCAG; tissue transglutaminase (TGM2), forward 5’-3’ AAGAGCGAAGGGACATACTG, reverse 5’-3’TGCATCATACTTGGTACTCAGG. Primers were obtained from Tib-MolBiol (Berlin,Germany) and Sigma-Aldrich (Taufkirchen, Germany).In addition, primers for matrix metalloproteinases ( MMP) and tissue inhibitors of MMP(TIMP) were ordered from Applied biosystems (Darmstadt) MMP2, Mm00439508_m1; MMP8, Mm 00439509_m1; MMP9, Mm 00442991_m1; MMP13, Mm00439491_m1; TIMP1, Mm 00441818_m1; TIMP2, Mm 00441825_m1; TIMP4 Mm00446568_m1.Electron microscopy Tissue samples were fixed in 3% glutaraldehyde (in 0.1 M phosphate buffer, pH 7.2), postfixed with 2% osmium tetroxide and embedded in araldite. Semi-thin sections were stained with toluidine blue and ultra-thin sections5 CIRCULATIONAHA/2007/714147 Version 3 with uranyl acetate and lead citrate followed by examination using a Zeiss EM 900 electron microscope. Quantification of collagen confluence was performed in infarct scars of 4 animals of each genotype. For this purpose electron microscopic images (3 per animal) at 7000-fold magnifications were used and the grid crossing method applied. Images taken from collagen rich-areas were overlaid by a grid of 20x20 fields.Using the grid-crossing technique the percentage of collagen fibrils oriented in parallel, tight arrangement (figure 7G) versus collagen fibrils presenting in a perturbed(crossed, twisted) and loose orientation (figure 7I) were analysed. Areas representing cytoplasma and nuclei were excluded. Tension to rupture measurementTensile force to rupture left ventricle ex vivo was measured as described by Gao et al.200415. Briefly, sham operated mice or mice 21 days post experimental myocardial infarction were sacrificed by overdose of Ketamin (100 mg/ml)/Xylazin (5 mg/kg).Hearts were removed and arrested immediately in iced PBS. Left ventricles were freed from atria and right ventricular tissue and cut into rings of 1 mm thickness. Rings were clamped on laminated steel wires connected to pre-calibrated force transducer and force to rupture (mN) was documented by integrated chart recorder15.Magnetic resonance imagingMagnetic resonance imaging (MRI) of the heart was performed using a Bruker DRX9.4 Tesla WB NMR spectrometer as described previously.16 6 CIRCULATIONAHA/2007/714147 Version 3References1. Xu T, Bianco P, Fisher LW, Longenecker G, Smith E, Goldstein S, Bonadio J, Boskey A, Heegaard AM, Sommer B, Satomura K, Dominguez P, Zhao C, Kulkarni AB, Robey PG, Young MF. Targeted disruption of the biglycan gene leads to an osteoporosis-like phenotype in mice. Nat Genet. 1998;20:78-82. 2. Petzelbauer P, Zacharowski PA, Miyazaki Y, Friedl P, Wickenhauser G, Castellino FJ, Groger M, Wolff K, Zacharowski K. The fibrin-derived peptide Bbeta15-42 protects the myocardium against ischemia-reperfusion injury. Nat Med. 2005;11:298-304. 3. Westermann D, Knollmann BC, Steendijk P, Rutschow S, Riad A, Pauschinger M, Potter JD, Schultheiss HP, Tschope C. Diltiazem treatment prevents diastolic heart failure in mice with familial hypertrophic cardiomyopathy. Eur J Heart Fail. 2006;8:115-21. 4. Steendijk P, Baan J. Comparison of intravenous and pulmonary artery injections of hypertonic saline for the assessment of conductance catheter parallel conductance. Cardiovasc Res. 2000;46:82-9. 5. Kasner M, Westermann D, Steendijk P, Gaub R, Wilkenshoff U, Weitmann K, Hoffmann W, Poller W, Schultheiss HP, Pauschinger M, Tschope C. Utility of Doppler echocardiography and tissue Doppler imaging in the estimation of diastolic function in heart failure with normal ejection fraction: a comparative Doppler- conductance catheterization study. Circulation. 2007;116:637-47. 6. Grossman W, Jones D, McLaurin LP. Wall stress and patterns of hypertrophy in the human left ventricle. J Clin Invest. 1975;56:56-64. 7. Schaefer L, Hausser H, Altenburger M, Ugorcakova J, August C, Fisher LW, Schaefer RM, Kresse H. Decorin, biglycan and their endocytosis receptor in rat renal cortex. Kidney Int. 1998;54:1529-41. 8. Schaefer L, Raslik I, Grone HJ, Schonherr E, Macakova K, Ugorcakova J, Budny S, Schaefer RM, Kresse H. Small proteoglycans in human diabetic nephropathy: discrepancy between glomerular expression and protein accumulation of decorin, biglycan, lumican, and fibromodulin. Faseb J. 2001;15:559-61. 9. Fisher LW, Stubbs JT, 3rd, Young MF. Antisera and cDNA probes to human and certain animal model bone matrix noncollagenous proteins. Acta Orthop Scand Suppl. 1995;266:61-5. 10. Movat HZ. Demonstration of all connective tissue elements in a single section. Arch. Pathol. 1955;60:289-295. 11. Schmidt R, Wirtala J. Modification of Movat Pentachrome Stain with improved reliabilyty of elastin staining. The Journal of Histotechnology. 1996;19. 12. Burke AP, Kolodgie FD, Farb A, Weber DK, Malcom GT, Smialek J, Virmani R. Healed plaque ruptures and sudden coronary death: evidence that subclinical rupture has a role in plaque progression. Circulation. 2001;103:934-40. 13. Dai G, Freudenberger T, Zipper P, Melchior A, Grether-Beck S, Rabausch B, de Groot J, Twarock S, Hanenberg H, Homey B, Krutmann J, Reifenberger J, Fischer JW. Chronic ultraviolet B irradiation causes loss of hyaluronic Acid from mouse dermis because of down-regulation of hyaluronic Acid synthases. Am J Pathol. 2007;171:1451-61.7 CIRCULATIONAHA/2007/714147 Version 314. Noutsias M, Pauschinger M, Ostermann K, Escher F, Blohm JH, Schultheiss H, Kuhl U. Digital image analysis system for the quantification of infiltrates and cell adhesion molecules in inflammatory cardiomyopathy. Med Sci Monit. 2002;8:MT59-71. 15. Gao XM, Xu Q, Kiriazis H, Dart AM, Du XJ. Mouse model of post-infarct ventricular rupture: time course, strain- and gender-dependency, tensile strength, and histopathology. Cardiovasc Res. 2005;65:469-77. 16. Jacoby C, Molojavyi A, Flogel U, Merx MW, Ding Z, Schrader J. Direct comparison of magnetic resonance imaging and conductance microcatheter in the evaluation of left ventricular function in mice. Basic Res Cardiol. 2006;101:87-95.8

Marterial and Methods

Details

Download

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

Support