Article Title: Significantly-Diverged Did2/Vps46 Orthologues from the Protozoan Parasite

Article Title: Significantly-Diverged Did2/Vps46 Orthologues from the Protozoan Parasite

<p>Article title: Significantly-diverged Did2/Vps46 orthologues from the protozoan parasite Giardia lamblia</p><p>Journal name: Current Microbiology</p><p>Author names: Somnath Dutta, Nabanita Saha, Atrayee Ray and Srimonti Sarkar Affiliation and email of corresponding author: </p><p>Department of Biochemistry (Room 226), Bose Institute, Centenary Campus, P 1/12 C.I.T. Scheme VII M, Kolkata </p><p>700054, West Bengal, India</p><p> [email protected]</p><p>Online Resource 1: Primers used in this study </p><p>Primer Sequence 5’ 3’ Purpose Primer1 CTACTTTGAAAGTATAGGAAGTCAGACATCGCAC Forward primer for VPS46 deletion TGAGAACGGATCCCCGGGTTAATTAA Primer2 AACGTAATGATGAACTAAAAATGCATGACCTGTT Reverse primer for VPS46 deletion AGCATGGAATTCGAGCTCGTTTAAAC Primer3 CGGGATCCAAAAAATGGGGAAG Forward primer to clone GlVPS46a into pUS234 Primer4 CCCAAGCTTCTTTGTCCGTTTAC Reverse primer to clone GlVPS46a into pUS234 Primer5 CGGGATCCAAAAATGGGCAAAG Forward primer to clone GlVPS46b into pUS234 Primer6 CCCAAGCTTGTGCATTTACACCATC Reverse primer to clone GlVPS46b into pUS234 Primer7 CGGGATCCCGCACTGAGAAATGTC Forward primer to clone ScVPS46 into pUS234 Primer8 CCCAAGCTTTTCAGCCCCTCAATG Reverse primer to clone ScVPS46 into pUS234 Primer9 GGGGAATTCGGCAAAAAAATG Forward primer to clone GlVPS46a into pET32a (+) Primer1 CCCAAGCTTCCGTTTACTCG Reverse primer to clone GlVPS46a 0 into pET32a (+) Primer1 CTGATGTTAAGAATCTCCGC Forward primer for reverse 1 transcriptase PCR of GlVPS46a Primer1 GATTTCCTTCGCATTCTCC Reverse primer for reverse 2 transcriptase PCR of GlVPS46a Primer1 GACCAGGCTATGGAGCTGAAG Forward primer for reverse 3 transcriptase PCR of GlVPS46b Primer1 GAGGTTTGCCTTTGTGTTGGC Reverse primer for reverse 4 transcriptase PCR of GlVPS46b Underlined sequences indicate restriction enzyme sites. Online Resource 2 : NCBI accession number of all the Vps46 orthologues used for sequence analysis</p><p>Organism Name Abbreviation used NCBI Accession Number Sequence length Giardia lamblia Gl XP_001708833.1 186 amino acids Giardia lamblia Gl XP_001705234.1 190 amino acids Danio rerio Dr AAH67665.1 198 amino acids Sus scrofa Ss NP_001230289 196 amino acids Macaca mulatta Mm1 NP_001078827.1 196 amino acids Bos taurus Bt NP_001178189.1 196 amino acids Homo sapiens Hs NP_002759.2 196 amino acids Gallus gallus Gg NP_001020611.1 196 amino acids Ictalurus punctatus Ip NP_001188220.1 198 amino acids Monodelphis domestica Md NP_001152895.1 196 amino acids Mus musculus Mm2 NP_663581.1 196 amino acids Xenopus laevis Xl NP_001084706.1 196 amino acids Auricularia delicate Ad XP_007343469.1 201 amino acids Saccharomyces cerevisiae Sc NP_012961.3 205 amino acids</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us