<p> 1 Supplementary Data</p><p>2 Optimizing cadmium and mercury specificity of </p><p>3 CadR-based E.coli biosensors by redesign of </p><p>4 CadR</p><p>5 HU-CHUN TAO*, ZHI-WEN PENG, PENG-SONG LI, TAI-AN YU, JIE SU</p><p>6 Key Laboratory for Heavy Metal Pollution Control and Reutilization, School of </p><p>7 Environment and Energy, Peking University Shenzhen Graduate School, Shenzhen, </p><p>8 518055, China</p><p>9 * Corresponding author: Tel.:+86-755-26032007; e-mail: [email protected];</p><p>10 Hu-Chun Tao*, e-mail: [email protected];</p><p>11 Zhi-Wen Peng, e-mail: [email protected];</p><p>12 Peng-Song Li, e-mail: [email protected];</p><p>13 Tai-An Yu, e-mail: [email protected];</p><p>14 Jie Su, e-mail: [email protected];</p><p>1 15 Supplementary Table 1 Bacterial strains and vectors used</p><p>Strain or plasmid Description Reference/source Strain E. coli TOP10 F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 Invitrogen, Carlsbad, ΔlacX74 recA1 araΔ139 Δ(ara-leu)7697 galU galK Calif. rpsL (StrR) endA1 nupG COG E. coli TOP10 transformed with pNTCOG, Kam This study COG-TC10 E. coli TOP10 transformed with pNTCOG-TC10, Kam This study COG-TC21 E. coli TOP10 transformed with pNTCOG-TC21, Kam This study Vector pMD18-TR pMD18-T vector (Takara, Shiga, Japan) containing cadR synthesized by Sangon gene (AF333961) Biotech, Shanghai, China pPROBE-NT a broad-host-range promoter-probe vector; containing gfp (Miller, Leveau et al. gene; 6.807kb; Kam; AF286453 2000) pNTCOG pPROBE-NT containing cadR gene; 7.29kb; Kam This study pNTCOG-TC10 pPROBE-NT containing cadR-TC10 gene; 7.257kb; Kam This study pNTCOG-TC21 pPROBE-NT containing cadR-TC21 gene; 7.224kb; Kam This study 16</p><p>17</p><p>2 18</p><p>19 Supplementary Table 2 Primer pairs used</p><p>Name Sequence (5’ to 3’) Description CadR-R CCCAAGCTTTTAATGCCCGTGGCTTCGCCCTACAT Amplification for cadR CadR-F CCGGAATTCGGGGTCATCCTTAATTTGAGCCTGTTGCC Amplification for cadR, cadR-TC10 and cadR-TC21 TC10-R CCCAAGCTTCTCGGTTTCCGGCACCGATAC Amplification for cadR- TC10 TC21-R CCCAAGCTTCTCCAGTTGCTGC Amplification for cadR- TC21 20</p><p>21</p><p>3 22</p><p>23</p><p>24</p><p>25 Supplementary Fig. 1 Growth curve of COG.</p><p>26</p><p>27</p><p>4 28 Supplementary Fig. 2 A model of CadR-TC21. The 3D structure modeling of CadR-TC21 was </p><p>29 constructed based on the crystal structure of CueR (Changela, Chen et al. 2003) using SWISS-MODEL </p><p>30 Workspace (Guex and Peitsch 1997; Schwede, Kopp et al. 2003; Arnold, Bordoli et al. 2006), QMEAN4 </p><p>31 score estimated model reliability was 0.702. The predicted structure and alignment scheme were used to </p><p>32 design a mutagenesis strategy and analyze the functionality changing of mutant proteins.</p><p>33</p><p>5 34 Supplementary Fig. 3 Alignment (Lee 2001) of CadR of P. putida 06909 with MerR of P. aeruginosa, </p><p>35 Cadr-TC10 and CadR-TC21. Identical bases are shown on a yellow background. Asterisks are Hg(II)-</p><p>36 binding cysteine residues of MerR, and numbers 1 to 7 are the heptad repeats that form dimerization helix</p><p>37 structures to promote homodimer formation. Histidine-rich in the C-terminal extension of CadR is white </p><p>38 characters on a green background. Helix-turn-helix motif for DNA binding is in N-terminal, and metal-</p><p>39 binding domain in C-termimal. </p><p>40</p><p>6 41 Supplementary Table 3 Equations </p><p>Strains Metals Equations R2 COG Zn 0.9944 Cd 0.9175 Hg 0.9994 COG-TC10 Zn 0.9578 Cd 0.9365 Hg 0.9958 COG-TC21 Zn 0.9031 Cd 0.9024 Hg 0.9876 42</p><p>43</p><p>7 44 References</p><p>45 Arnold K, Bordoli L, Kopp J, Schwede T (2006) The SWISS-MODEL workspace: a web-based environment for </p><p>46 protein structure homology modelling. Bioinformatics 22(2): 195-201. doi: 10.1093/bioinformatics/bti770</p><p>47 Changela A, Chen K, Xue Y, Holschen J, Outten CE, O'Halloran TV, Mondragón A (2003) Molecular Basis of Metal-</p><p>48 Ion Selectivity and Zeptomolar Sensitivity by CueR. Science 301(5638): 1383-1387. doi: 10.1126/science.1085950</p><p>49 Guex N, Peitsch MC (1997) SWISS‐ MODEL and the Swiss ‐ Pdb Viewer: An environment for comparative protein 50 modeling. Electrophoresis 18(15): 2714-2723. doi: 10.1002/elps.1150181505</p><p>51 Lee SW, Glickmann E, Cooksey DA (2001) Chromosomal locus for cadmium resistance in Pseudomonas putida </p><p>52 consisting of a cadmium transporting ATPase and a MerR family response regulator. Appl Environ Microb 67(4): </p><p>53 1437-1444. doi: 10.1128/aem.00863-07</p><p>54 Miller WG, Leveau JHJ, Lindow SE (2000) Improved gfp and inaZ broad-host-range promoter-probe vectors. Mol </p><p>55 Plant Microbe In 13(11): 1243-1250. doi: 10.1094/mpmi.2000.13.11.1243</p><p>56 Schwede T, Kopp J, Guex N, Peitsch MC (2003) SWISS-MODEL: an automated protein homology-modeling server. </p><p>57 Nucleic Acids Res 31(13): 3381-3385. doi: 10.1093/nar/gkg520</p><p>58</p><p>59</p><p>8</p>