<p>Molecular cloning, Purification and Functional implications of recombinant GST tagged hGMCSF cytokine</p><p>Nidhi Chaubey a, Siddhartha Sankar Ghosh*ab</p><p>Received (in XXX, XXX) Xth XXXXXXXXX 20XX, Accepted Xth XXXXXXXXX 20XX DOI: 10.1039/b000000x</p><p>Cloning:</p><p>GMCSF gene was amplified by PCR from human renal carcinoma ACHN cell line. Gene specific primers were designed based on cDNA sequence with NCBI Accession Number NM- 000758.29. Forward (A) and reverse (B) primer sequences were ATGTGGCTGCAGAGCCTGCTG, TCACTCCTGGACTGGCTCCCA, respectively, for GMCSF cloning in pGEMT Easy vector. RNA was isolated from ACHN cells by TRIsure (sigma, USA). RT-PCR was performed by M-MLV reverse transcriptase (sigma, USA) at 370C for 50 minutes in 20µl of reaction volume using oligo dT primers and 1µg of total RNA.</p><p>PCR amplification was carried out using 1µl of RT product with gene specific primers. Initial denaturation step was carried out at 950C for 5 minutes followed by PCR cycle denaturation at 950C for 30 seconds, annealing at 55.40C for 45 seconds, extension at 720C for 1 min and final extension at 720C for 5 minutes. PCR products were purified by phenol chloroform extraction procedure and then ligated with pGEM-T Easy vector (Promega). The ligated products were transformed in E.coli by heat shock method. The recombinant colonies were screened by blue white screening and the clones were confirmed by the release of 435 bp hGMCSF fragment by EcoRI digestion (Fig.1). The DNA sequence was confirmed by sequencing. Fig.1: Digestion of pGEM-T Easy-hGMCSF with EcoRI. Lane 1, PCR amplicon; Lane 2, NEB Hyperladder marker; Lane 3, pGEMT-Easy GMCSF clone digested with EcoRI; Lane 4, Uncut plasmid of pGEM-T Easy-GMCSF; Lane 5, Uncut pGEMT; Lane 6, pGEM-T Easy digested with EcoRI.</p><p>A second round of PCR amplification of hGMCSF was performed by using pGEMT Easy GMCSF as template with primers having BamHI and XhoI linker sites, designed to clone in to the N terminal GST tagged bacterial expression vector pGEX4T2 (Amersham). The following forward (C) 5’- GTGGATCCATGTGGCTGCAGAGCCT-3’ and reverse (D) 5’- GACTCGAGTCACTCCTGGACTGGCTC-3’ primers were used for PCR amplification and cloning to pGEX4T2 vector. The release of 435bp hGMCSF fragment from the pGEX4T2- GMCSF plasmid was observed upon double digestion with Bam HI and Xho I enzymes (Fig. 2).</p><p>Fig 2: GMCSF in pGEX4T2 Bacterial expression vector. Lane 1, pGEX4T2- hGMCSF uncut; Lane2, Marker; Lane3, pGEX4T2-hGMCSF digested with Bam HI and Xho1.</p><p>Cell proliferation: hGMCSF mediated cell proliferation was checked by flow cytometric analysis with carboxyfluorescein diacetate succinimidyl diacetate ester (CFDA-SE). Cells were incubated with 5mM CFDA-SE (Sigma) for 5 min. and subsequently seeded in 6 well plate for further growth. After 24 hrs of seeding, cells were taken out by trypsinization, washed and further proceeded for analysis by flow cytometric analysis (BD Biosciences). Data was showing some minimization in the doubling time of stable transfected GMCSF in MCF-7 breast cancer cell line as compare to untransfected MCF-7. MALDI analysis additional Information:</p><p>In MALDI analysis we found that the tryptic digested fragments matched with 2133.9124 Da peptide with human CSF2 in NCBI blast through inbuilt MASCOT database program. We found a score value of 179 and expect 2e-014. </p>