Figure S3. Genetic Depletion of Cohesin from G1-Arrested Mouse Pre-B Cells

Figure S3. Genetic Depletion of Cohesin from G1-Arrested Mouse Pre-B Cells

<p>1 Lavagnolli_251835 Figure S1. The DNA polymerase inhibitor aphidicolin abrogates reprogramming by</p><p>ES cells transduced with Myc. Quantitative RT-PCR was used to monitor the ability of mES cells transduced with Myc expression vector (Myc-IRES-GFP) to induced POU5F1 </p><p>(OCT4), NANOG, CRIPTO and REX1 in heterokaryons with hB cells in the absence and the presence of the DNA polymerase inhibitor aphidicolin. Normalised to GAPDH, mean </p><p>± SD, n=3.</p><p>Figure S2. Reduced frequency of hybrid generation from heterokaryons between </p><p>ES cells and cohesin-deficient somatic cells. </p><p>(A) Generation of intraspecies heterokaryons between ZHBTc4 (Pou5f1 ko) ES cells reconstituted with a Pou5f1 (Oct4βgeo) cDNA transgene to express wild-type Oct4 levels (Niwa et al., 2000) and control (Rad21lox/lox) or cohesin-deficient (Rad21-/-) mouse thymocytes harbouring an Oct4-GFP transgene. This strategy allows the detection of mRNA derived from the endogenous Pou5f1 locus, which is wild type in thymocytes but defective in ZHBTc4 (Pou5f1 ko) ES cells and from the Oct4-GFP transgene. </p><p>(B) Expression of thymocyte-derived Pou5f1 (endogenous Oct4) and Oct4-GFP was analysed in heterokaryons 1-3 days after fusion. Control and cohesin-deficient thymocytes activated Oct4-GFP transgene expression with similar efficiency in ES cell heterokaryons, but the endogenous Pou5f1 (Oct4) locus was induced more efficiently in control than in cohesin-deficient thymocytes. Normalised to Gapdh, mean ± SD, n=3, * p<0.05, ** p<0.001 (T-test).</p><p>(C) GFP+ cells were isolated by flow cytometry 9 days after fusion, re-plated, and hybrid colonies were counted and analysed for alkaline phosphatase expression 15 days after fusion.</p><p>Figure S3. Genetic depletion of cohesin from G1-arrested mouse pre-B cells. 2</p><p>(A) Schematic of conditional cohesin depletion in ERt2Cre Rad21+/lox and Rad21lox/lox pre-</p><p>B cells. 4’OHT was added to Abelson-transformed pre-B cells to initiate the deletion of </p><p>Rad21. Two days later, the Abelson kinase inhibitor STI571 was used to arrest pre-B cells in the G1 phase of the cell cycle. </p><p>(B) Propidium iodide staining and flow cytometric analysis of DNA content showed that over 98% of pre-B cells were in the G1 phase of the cell cycle 48h after STI571 treatment.</p><p>(C) Quantitative RT-PCR analysis showed depletion of Rad21 mRNA expression in </p><p>Rad21lox/lox pre-B cells 4 days after ERt2Cre induction (normalised to Ubc, mean ± SD, n=3).</p><p>(D) Western blotting showed depletion of Rad21 protein expression in Rad21lox/lox pre-B cells 4 days after ERt2Cre induction. Tubulin is a loading control. Representative of 3 independent experiments.</p><p>Figure S4. Impaired reprogramming of Smc3-deficient somatic cells in ES cell heterokaryons. Heterokaryons between hES cells and control pre-B cells (Ert2Cre </p><p>Smc3+/lox) or pre-B cells conditionally depleted of the cohesin subunit Smc3 (Ert2Cre </p><p>Smc3lox/lox) were established and analysed as shown for conditionally Rad21-deficient pre-B cells in Fig. 5D. </p><p>A) Genetic depletion of Smc3 mRNA (left) and protein (right) from mouse pre-B cells.</p><p>B) Quantitative RT-PCR with primers that selective for transcripts was used to monitor the activation of pluripotency markers Pou5F1, Nanog and Cripto. Normalised to Gapdh, mean ± SD, n=3, * p<0.05, ** p<0.001 (T-test).</p><p>Figure S5. p53 target gene expression and characterisation of somatic nuclei in </p><p>ES cell heterokaryons. 2 3 Lavagnolli_251835 (A) Quantitative RT-PCR analysis showed that neither control nor cohesin-deficient mouse thymocytes initiated the expression of the p53 target genes Cdkn1a (p21), </p><p>Mdm2, Cdkn2b (p15) or Cdkn2a (p16) in ES cell heterokaryons. Normalised to Gapdh, mean ± SD, n=3.</p><p>(B) Identification of ES cell and somatic nuclei in mouse-mouse heterokaryons. Left: </p><p>Mouse ES cells were pre-labelled with EdU (10M overnight) prior to fusion with mouse pre-B cells to discriminate ES cell and somatic nuclei. ES cell nuclei are marked by EdU, somatic nuclei are smaller and show a distinctive distribution of pericentromeric heterochromatin foci (outlined). Blue: DAPI; Red: Actin; Pink: EdU; scale bar = 10 m. </p><p>Right: Mouse thymocyte nuclei prior to fusion are small and show a distinctive distribution of DAPI-dense pericentromeric heterochromatin foci. Rad21 staining of a representative control and cohesin-deficient cell. Scale bar = 5m. </p><p>NEW Table S1 (Excel file). Extended list of genes targeted by at least 5 pluripotency factors in ES cels (Lin et al., 2012).</p><p>Table S2. RT-PCR primers.</p><p>Table S3. ChIP-PCR primers.</p><p>Table S4. 3C primers. 4</p><p>Table S2. Primers for the selective amplification of human (h) or mouse (m) transcripts by quantitative RT-PCR.</p><p>Sequence 5’-3’ hGAPDH forward TCTGCTCCTCCTGTTCGACA reverse AAAAGCAGCCCTGGTGACC hPOU5F1 (OCT4) forward TCGAGAACCGAGTGAGAGGC reverse CACACTCGGACCACATCCTTC hNANOG forward CCAACATCCTGAACCTCAGCTAC reverse GCCTTCTGCGTCACACCATT hCRIPTO forward AGAAGTGTTCCCTGTGTAAATGCTG reverse CACGAGGTGCTCATCCATCA hSOX2 forward CACACTGCCCCTCTCACACAT reverse CATTTCCCTCGTTTTTCTTTGAA hREX1 forward GCGTACGCAAATTAAAGTCCAGA reverse CAGCATCCTAAACAGCTCGCAGAAT hCD37 forward GTGGCTGCACAACAACCTTATTT reverse GCCTAACGGTATCGAGCGAG hCD19 forward GCTCAAGACGCTGGAAAGTATTATT reverse GATAAGCCAAAGTCACAGCTGAGA hCD45 forward CCCCATGAACGTTACCATTTG reverse GATAGTCTCCATTGTGAAAATAGGCC hCCNE1 forward ACAGCTTGGATTTGCTGGAC reverse TCTGCTTCTTACCGCTCTGTG Sequence 5’-3’ mGapdh forward TGCACCACCAACTGCTTAGC reverse GGCATGGACTGTGGTCATGAG mUbc forward AGGAGGCTGATGAAGGAGCTTGA reverse TGGTTTGAATGGATACTCTGCTGGA mYwhaz forward CGTTGTAGGAGCCCGTAGGTCAT reverse TCTGGTTGCGAAGCATTGGG mPou5f1 (Oct4) forward CGTGGAGACTTTGCAGCCTG reverse GCTTGGCAAACTGTTCTAGCTCCT endogenous forward CAAGGCTTCTCACCTCCAGA mPou5f1 (Oct4) reverse TGCTGTACTAGAGTGCGACAGAG mNanog forward GAACTATTCTTGCTTACAAGGGTCTGC reverse GCATCTTCTGCTTCCTGGCAA mCripto forward CACCAACCCAGGGTATCAGTT reverse AGAGTTCTGTCCAGTGTCGTC mSox2 forward GAGTGGAAACTTTTGTCCGAGA reverse GAAGCGTGTACTTATCCTTCTTCAT mRex1 forward CTCCTAGCCGCCTAGATTTCCA reverse CGTGTCCCAGCTCTTAGTCCATT mCd19 forward AAGGTCATTGCAAGGTCAGC reverse CTGGGACTATCCATCCACCA mCd10 forward ACTTTTCCTGGGACCTAGCAG reverse CCATTATCAGCAATGTTTTCTCC mPax5 forward ACGCAAGAGGGATGAAGGTA reverse TGCTGTGTGAACAGGTCTCC mCd4 forward TTCGGCATGACACTCTCAGT reverse GCAAAGTTGAGTGGGAAGGA mCd28 forward CTGGCCCTCATCAGAACAAT reverse GGGCGACTGCTTTACCAA mCd34 forward TGCCTGGAACTAAGTGAAGCA reverse GCCTCCTCCTTTTCACACAG mRad21 forward AGGAAGAAGCTTTTGCGTTG reverse CGCTAAGCTGGGCTCTAATG</p><p>4 5 Lavagnolli_251835 mSmc3 forward GATCCCTTCAGCTCCAAACA reverse CTGAGAACAAACTGGATTGCAT mMyc forward TTCATCTGCGATCCTGACGAC reverse AGGGGTCAATGCACTCGGA mCdkn1a (p21) forward GCAGACCAGCCTGACAGATT reverse GAGGGCTAAGGCCGAAGA mMdm2 forward TGTGTGAGCTGAGGGAGATG reverse CACTTACGCCATCGTCAAGA mCdkn2b (p15) forward AGACTGCAAGCACGAAGAGG reverse TTGTCTTACTGGGTAGGGTTCAA mCdkn2a (p16) forward AATCTCCGCGAGGAAAGC reverse GTCTGCAGCGGACTCCAT mLefty1 forward GTTCAGCCAGAACCTTCGAG reverse GCTCCATTCCGAACACTAGC mKlf4 forward TCCTTTCCAACTCGCTAACCC reverse CGGATCGGATAGCTGAAGCTG GFP forward CACATGAAGCAGCACGACTT reverse AGTTCACCTTGATGCCGTTC</p><p>RT-PCR primers for the detection of mouse transcripts in Xenopus reprogramming experiments.</p><p>Sequence 5’-3’ Pou5f1 forward AGGATAATACGACTCACTATAGGGAGCTAGAACAGTTTGCCAAGCTGCTG reverse CTGGTGAATTAACCCTCACTAAAGGGAGAGCCCAGAGCAGTGACGGGAAC Sox2 forward AGGAGGCTGATGAAGGAGCTTGA reverse TGGTTTGAATGGATACTCTGCTGGA Gapdh forward CGTTGTAGGAGCCCGTAGGTCAT reverse TCTGGTTGCGAAGCATTGGG</p><p>Table S3. ChIP-PCR primers.</p><p>Position Forward primer Reverse primer Nanog promoter CCCTTTAAATCTATCGCCTTGA AAGGTTTTAGGCAACAACCAAA Nanog enhancer ACTCCAAGGCTAGCGATTCA CTTATCCAGGGAAGCGGTTT</p><p>Lefty1 promoter ACTGGTCTCGAGCCAAGAAA AAGACTCGTCCCTGGTGTGT Lefty1 enhancer TTGCACAATGGGCTTGATTA GCAGGGTGACAAACTTGGTT</p><p>Klf4 p1 (TSS) CGCCTCTTGCTTAATCTTGG TTAGCAAAGGAAGCCCAGAC Klf4 p2 (TSS+15kb) TTCCAGTCCAGTCCCAAGTC CCTGGATGGTCTACGTGCTT Klf4 p3 (TSS +50kb) CTTGGACACGGTTTTGGTTT ACTGTGATGTGGCTCTGTCG Klf4 p4 (TSS +53kb) CAACTTGGCAACCTCCTCAT ACCTGTGCTTTCTGGAGTGG Klf4 p5 (TSS +55kb) TGTGGCCTGGATCCCTAATA CTCTCCCCACGAATTAACGA Klf4 p6 (TSS +66kb) TCCCTTGCTAGGCGATAATG GGAGCAAGGAACTTGGCTTA 6</p><p>Table S4. 3C primers.</p><p>Nanog 3C:</p><p>Taqman probe [FAM]-TAT CAA GAA GTC AGA AGG AAG TGA GCC GC-[BHQ1] Distance from anchor (kb) 3C primer Reverse primer Anchor TGGCCTTCAGATAGGCTGAT CCAGGAAGACCCACACTCAT Normalization fragment AAACGGGCTGAAGGGTTATT CCCCGAACATATTCCAAAGA 3.6 TGAAGACTGCTTTCTCTGtcc CGGACTAACCAAGGGCTACA 4.3 CTCGAATGTTGGGCTTAGGA TTCTGCCACTCACACCTCAG 5.1 CCCTCCTCCCTATTCAAACC AGTCAAGGCCACCATAGCC 6 GTGGGTGCACACAGAGAACA AGGACATGCGTTCAGTCTCC 8.25 ATGCATTTCATCCCAGCACT TGGGGTTGGAAAAGTCAAAG 9.1 CTGGAGAGTATTGCGCCTTC CTGGGTTGGTGAAGATTCCA 12.7 GGTGGAGTGGCATACACCTT CCTGTGGTCTGCTCTCCATT 13.4 CACCCCCAGACAGACTGATT CAACCAGCCCAGGTTTCTAA Lefty1 3C:</p><p>Taqman probe [FAM]-CTT CCC TGA GGC TAA CCA GCG ACA GTG-[BHQ] Distance from anchor (kb) 3C primer Reverse primer Anchor CAGGGACACACACATCCAAG TGTTGTAGCAGGGCCACATA Normalization fragment GTCCTGGACAAGGCTGATGT ACACCACAGGTGGAAGGAAG 2.7 AGGAGGAGCAAAGGAAGAGC CACTGTTAACATACTTGAGAGGTGAAA 4.44 CGCAAGCAGGATGTTTTCA TGGTTCTCTCCTCCCATCAT 6 GCACTGAGCGATACAAACCA TTTTCTGGCATTAGCAAGCA 9.07 CCCAGTCTTTATGCCATGCT AGTTTACCCATCCCCTCACC 10.8 AGGGGCAGAGAACATTTGAA TCTTTAACGATGCTGCGATG 12.3 TGGTCGCCTCACTCCTAGTC TGAGGAGAGACTGCCATGTG 14.46 GCTGTGTCCAGCCCTCTTAG GGCCAGCATCTCAGCTTTAC 15.22 CTTTGGCTGCTCCTATCTGG GAATCCCTCCCTGGCTACTC 16.6 ACGGATGGCAGACCTGTAAG CCTAAGAAGCCACCTTGCAC 19.1 AGGATGACATAGCCCAGCAC CAGCTCCAGGAACAGACCAT Klf4 3C:</p><p>Taqman probe [FAM]-TCGTGGGAAGACAGTGTGAAAGGTTAGAAA-[BHQ1] Distance from anchor (kb) 3C primer Reverse primer Anchor TCCCACGTAGTGGATGTGAC CCATTCACAAGCTGACTTGC Normalization fragment CAAAAACCGTGAGTGTGGTG CGAGTGCCTTTCTTCAGTCC 8.4 CGGAGGCAGGAAGATTAAGA ACTCCTGCTGATGGTTGGAC 12 ACTGTTGGCCAAAGAGAGGA TGGCCTCGAACTCAGAAATC 13.4 AGAAATGCAAAGCCCCTAGC GCTGGTTGACTGTGTGAGGA 15.1 GCTGGTTGACTGTGTGAGGA AGAAATGCAAAGCCCCTAGC 24.2 AGCATCAGGACCAGAATTCAA TATCCTGCACGGTTCACAAA 33.4 TCCTGGCCTGCTGTAGAGAT ACAATTCTGGAGGGAGGACA</p><p>6 7 Lavagnolli_251835</p><p>44.2 AGAAGCACAGGCAGGACCTA GTGGAACGTTAAGGCTGGAA 48 CTCAATCCGTCTGTGCTGTG CGGACTTCTCCACGAATCAT 49.4 TTGACCTCCATCCACATGAA AGAGTTTGCCTGGCTGTGTT 49.7 GCAGGAGTCAGTTCCCAGAG ACTTCCTGCCCAGCTCAGTA 51.2 CAACTTGGCAACCTCCTCAT ACCTGTGCTTTCTGGAGTGG 51.4 GGAACACAATCAAGGTCAGGA TGGGCAGAGAGTGGAAAGTT 53.8 TGTGGCCTGGATCCCTAATA CTCTCCCCACGAATTAACGA 56 ATGTCCTGAAGGTTGGCTGT TGCTGAATAGGCACTGGTTG 58.2 TCATTTGTCCTCCCTCCACT GGCAGATCACAGGAACACCT 64 TACCATCACAAACCGGACAA CTATGGCAGGCAGGAGACAT</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    7 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us