
Airway biology Dysregulation of elastin expression by fibroblasts in Thorax: first published as 10.1136/thx.2007.093302 on 11 July 2008. Downloaded from pulmonary emphysema: role of cellular retinoic acid binding protein 2 L Plantier,1,2,3 C Rochette-Egly,4 D Goven,1 A Boutten,1,5 M Bonay,1,6 G Lese`che,3,7 M Fournier,2,3 B Crestani,1,2,3 J Boczkowski1,8 1 INSERM U700, Hoˆpital Bichat, ABSTRACT in the lung is a stimulus for the alveologenesis 2 Paris, France; Services de Background: All-trans retinoic acid (ATRA) stimulates phase of lung development3; secondly, all-trans Pneumologie, Hoˆpital Bichat, elastin synthesis by lung fibroblasts and induces alveolar retinoic acid (ATRA) induces the expression of Assistance Publique-Hoˆpitaux de 4 Paris, Paris, France; 3 Universite´ regeneration in animal models of pulmonary emphysema. elastin in lung fibroblasts ; thirdly, vitamin A Paris 7, UFR me´dicale Denis However, ATRA treatment has had disappointing results deficiency leads to an emphysema-like phenotype Diderot, Faculte´Bichat, Paris, in human emphysema. It was hypothesised that a defect in the lung of adult rats5; finally, the systemic 4 France; Institut de Ge´ne´tique in the ATRA signalling pathway contributes to the defect administration of ATRA has been reported to et de Biologie Mole´culaire et Cellulaire, Strasbourg, France; of alveolar repair in the human emphysematous lung. abrogate elastase induced emphysema in adult rats 5 Service de Biochimie A, Hoˆpital Methods: Fibroblasts were cultured from the lung of 10 and mice.67 Retinoic acid exerts its effects by Bichat, Assistance Publique- control subjects and eight patients with emphysema. binding two families of nuclear receptors, the Hoˆpitaux de Paris, Paris, France; Elastin and retinoic acid receptor (RAR)-b mRNAs were retinoic acid receptors (RAR-a, b and c) and the 6 Service de Physiologie, Hoˆpital retinoid X receptors (RXR-a,b and c), which Bichat, Assistance Publique- measured in those cells in the presence of incremental Hoˆpitaux de Paris, Paris, France; concentrations of ATRA. RARs, retinoic X receptors translocate to the nucleus on binding where they 7 Service de Chirurgie (RXRs) and cellular retinoic acid binding protein (CRABP) 1 act as transcription factors.8 The binding of Thoracique et Vasculaire, Hoˆpital and 2 mRNAs were measured as well as CRABP2 protein retinoic acid to RARs and the transcriptional Bichat, Assistance Publique- content. The effect of CRABP2 silencing on elastin and activity of RARs are greatly enhanced by a Hoˆpitaux de Paris, Paris, France; 8 CIC 07, Hoˆpital Bichat, RAR-b expression in response to ATRA was measured in 15 kDa cytosolic protein, cellular retinoic acid 9–11 Assistance Publique-Hoˆpitaux de MRC5 lung fibroblasts. binding protein 2 (CRABP2). Paris, Paris, France Results: ATRA at 1029 M and 1028 M increased median In light of those elements, we hypothesised that elastin mRNA expression by 182% and 126% in control an alteration in the retinoic acid signalling path- Correspondence to: Dr L Plantier, Service de but not in emphysema fibroblasts. RAR-b mRNA way might contribute to the defect of alveolar Pneumologie B, Hoˆpital Bichat, expression was induced by ATRA in control as well as repair that is observed in human pulmonary http://thorax.bmj.com/ 16 rue Henri Huchard, 75877, emphysema fibroblasts. RARs, RXRs and CRABP1 mRNAs emphysema. To explore this hypothesis, we Paris Cedex 18, France; focused on elastin production by lung fibroblasts. laurent.plantier@ were similarly expressed in control and emphysema bch.aphp.fr fibroblasts while CRABP2 mRNA and protein were lower We first determined whether ATRA induced in emphysema fibroblasts. CRABP2 silencing abrogated elastin and RAR-b mRNA expression in lung Received 14 November 2007 the induction of elastin but not RAR-b expression by fibroblasts cultured ex vivo from human control Accepted 7 June 2008 ATRA in MRC5 fibroblasts. and emphysematous lung samples. Then, expres- Published Online First Conclusion: Pulmonary emphysema fibroblasts fail to sion of RAR-a, RAR-b, RAR-c, RXR-a, RXR-b, 11 July 2008 express elastin under ATRA stimulation. CRABP2, which is RXR-c, CRABP1 and CRABP2 was determined in on September 30, 2021 by guest. Protected copyright. necessary for elastin induction by ATRA in MRC-5 cells, is those cells. As we found a selective reduction in expressed at low levels in emphysema fibroblasts. This CRABP2 expression in fibroblasts from emphyse- alteration in the retinoic acid signalling pathway in lung matous patients, we determined whether suppres- fibroblasts may contribute to the defect of alveolar repair sion of CRABP2 expression in lung fibroblasts in human pulmonary emphysema. These results are the using a siRNA strategy abolished the induction of first demonstration of the involvement of CRABP2 in elastin expression by retinoic acid. elastin expression. MATERIALS AND METHODS Lung samples Pulmonary emphysema is a chronic degenerative lung disease characterised by an imbalance The study was approved by the ethics committee between alveolar destruction and repair which of Paris-Bichat University Hospital, Paris, France. results in the progressive destruction of pulmonary Patients gave informed consent. alveoli and chronic respiratory failure. Lung fibro- blasts and myofibroblasts play a major role in the Emphysema patients course of pulmonary repair processes,1 notably Fibroblasts were cultured from lung samples from through the secretion of elastin, an essential eight patients with severe pulmonary emphysema component of the pulmonary extracellular matrix.2 undergoing lung volume reduction surgery (n = 3) Signalling by retinoic acid, the main active or lung transplantation (n = 5). Median age of the metabolite of vitamin A, is of particular impor- patients was 58 years (interquartile range (IQR) tance for the development, maintenance and repair 53, 58.5). All patients were smokers or ex-smokers of pulmonary alveoli, as assessed by the following (33 pack-years, IQR 30, 38) and had normal plasma arguments: firstly, elevation of retinoic acid levels a1 antitrypsin levels. Emphysema was diagnosed in 1012 Thorax 2008;63:1012–1017. doi:10.1136/thx.2007.093302 Airway biology Table 1 Sequence of primers used for reverse transcription-PCR experiments Thorax: first published as 10.1136/thx.2007.093302 on 11 July 2008. Downloaded from Gene Forward primer Reverse primer Ubiquitin C CACTTGGTCCTGCGCTTGA TTTTTTGGGAATGCAACAACTTT Elastin GAGCTTTTGCTGGAATCCCA GGCAGTTTCCCTGTGGTGTAG CRABP1 AGCCGCTACGGCACTTT AATTTCGACGAGCTGCTGAAG CRABP2 CAAACAGGAGGGAGACACTTTCTAC CTCCTCCCCAACCTTGAAGTTA RAR-a CCTCTGGGACAAGTTCAGTCAACT GTGCAGATCCGCAGCATCA RAR-b TTAAGATCGTGGAGTTTGCTAAACG GGGTAAGGCCGTCTGAGAAAGT RAR-c GAGCCTGGGTTTGGACTCTAAAAT TCTCTAGTGTTCCTGTTTGCTCTCA RXR-a AGGCGCTGAGGGAGAAGGT AGGAAGGTGTCAATGGGTGTGT RXR-b CGGTCCATTGGCCTTAAGTG TCTCCATGAGGAAGGTGTCGAT RXR-c GGTCAACAGTGTCAGCAGTTCAGA CGGGAGGTAGTTCATGTTTCCAATCCCG CRABP, cellular retinoic acid binding protein; RAR, retinoic acid receptor; RXR, retinoic X receptor. the presence of an obstructive ventilatory disorder and over- instructions. Quantitative real time PCR using a SybrGreen distension on lung function tests associated with characteristic fluorochrome (Sigma, St Quentin-Fallavier, France) was per- chest CT and histological findings, and the absence of any formed with a Mx3000P thermocycler (Stratagene, La Jolla, associated lung disease was verified. The median total lung California, USA) to quantify elastin and RAR-b cDNAs as well as capacity of patients with emphysema was 127% predicted (IQR ubiquitin C (UBC) cDNA as an endogenous control.13 cDNA 122, 129) and median forced expiratory volume in 1 s 28% copy numbers were expressed relative to a standard prepared predicted (IQR 18, 35). from pooled lung fibroblast cDNAs that were used for all experiments. Amplification specificity was verified by agarose gel Control patients electrophoresis and melting curves. Fibroblasts were cultured from lung samples from 10 patients undergoing lung surgery for cancer. The age of the control Determination of the intracellular content of fibroblasts in RAR, subjects (68 years, IQR 65, 71) was not different from that of RXR, CRABP1 and CRABP2 mRNA in the absence of stimulation patients with emphysema (p = 0.13). Lung samples were taken RAR-a, RAR-b, RAR-c, RXR-a, RXR-b, RXR-c, CRABP1 and from an uninvolved segment, and the absence of emphysema CRABP2 mRNAs were quantified by reverse transcription-PCR was verified microscopically. Five patients were active or past in unstimulated control and emphysema fibroblasts, as smokers (36 pack-years, IQR 30, 40) and five were never- described above. Primers sequences are listed in table 1. smokers. The median total lung capacity of the control patients http://thorax.bmj.com/ was 98% predicted (IQR 86, 114) and their median forced Determination of the intracellular content of CRABP2 protein in expiratory volume in 1 s was 90% predicted (IQR 75, 107). fibroblasts Fibroblasts at passage 5 were cultured to confluence in 75 cm2 Isolation of pulmonary fibroblasts flasks (Corning, Schiphol-Rijk, The Netherlands). Cells were Pulmonary fibroblasts were cultured from lung explants, as rinsed twice with phosphate buffered saline (Gibco/Invitrogen) previously described.12 Fibroblasts were cultured with DMEM and proteins were extracted with Cytobuster Protein Extraction culture medium (Gibco/Invitrogen, Cergy-Pontoise, France) with Reagent (Novagen, Madison, USA) according to the manufac- 10% fetal calf serum (Fetalclone
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages6 Page
-
File Size-