
<p>Full title:</p><p>A functional variant of the Collagen Type III alpha1 gene modify risk of sporadic intracranial aneurysms</p><p>Human Genetics</p><p>Authors’ names, academic degrees, and affiliations:</p><p>Jingzhou Chen, Ph.D.1, ||, Yufang Zhu, Ph.D.2, ||, Yuhua Jiang, M.S.3, || , Hui Yu, M.S.1, </p><p>Kai Sun, Ph.D.1 , Weihua Song, Ph.D.1, Liming Luan, M.D.4, Kejia Lou, B.S.1, </p><p>Youxiang Li, M.D.3, Peng Jiang, Ph.D.3, *, Qi Pang, M.D., Ph.D.4, *, Rutai Hui, M.D., </p><p>Ph.D.1, *</p><p>1Sino-German Laboratory for Molecular Medicine, State Key Laboratory of</p><p>Cardiovascular Disease, Fuwai Hospital, National Center for Cardiovascular</p><p>Diseases , Chinese Academy of Medical Sciences and Peking Union Medical</p><p>College, Beijing, 100037, People's Republic of China</p><p>2Department of Surgery, Shandong Tumor Hospital, Jinan, 250117, China</p><p>3Department of Interventional Neurosurgery, Beijing Neurosurgical institute and</p><p>Beijing Tiantan Hospital, Capital Medical University, Beijing 100050, China</p><p>4Department of Neurosurgery, Shandong Provincial Hospital, Shandong University, </p><p>Shandong, 250021, China</p><p>|| Contributed equally to this work.</p><p>* Corresponding authors</p><p>Name and complete address for correspondence:</p><p>Correspondence to Rutai Hui, Qi Pang, or Peng Jiang</p><p>Address for reprints</p><p>Rutai Hui, MD, PhD,</p><p>167 Beilishilu, Beijing 100037, China.</p><p>1 Fax: 8610-68331730; Tel: 8610-68333902</p><p>Email: huirutai@ gmail .com</p><p>Qi Pang, MD, PhD, </p><p>324 Jingwuweiqi Road, Jinan, Shandong, 250021 China.</p><p>Fax: 86-531-85186394; Tel: 86-531-86676688,</p><p>Email: [email protected]</p><p>Peng Jiang, MD, </p><p>6, Tiantan, Xili, 100050, Beijing, China.</p><p>Fax: 86-10-67098849; Tel: 86-10-67098850,</p><p>Email: [email protected]</p><p>2 Supplementary Method</p><p>Genotyping Variants of COL3A1</p><p>The variants rs1800255, rs2138533 and rs11887092 were genotyped by ligase detection reaction (LDR) in Shanghai Biowing Applied Biotechnology Co., Ltd.. The primer and probe sequences and PCR and LDR product lengths of the three variants are summarized in TableS4. Fragment amplification was carried out in 20µL of</p><p>Multiplex PCR reaction mixture containing 50 ng (1µL) of genomic DNA, 2µL</p><p>1×Buffer, 0.6µL Mg2+, 2µL dNTPs, 0.2µL Taq polymerase, 4µL 1 ×Q-solution,</p><p>0.4µL Primer mix, 9.8µL ddH2O. PCR reaction included initial denaturing at 95°C for</p><p>15 minutes, 35 cycles of denature at 94°C for 30 seconds, annealing at 65°C for 1 minute, and extension at 72°C for 1 minute. The reaction was completed by a final extension at 72°C for 7 minutes with the use of a thermal cycler Gene Amp PCR system 9600 (Perkin Elmer, Waltham, Massachusetts,USA). Further amplification was performed in 10µL volume of Multiplex LDR reaction mixture, containing the resultant PCR product of 1µL (100ng), 1μl Probe mix, 0.05μl NEB Taq DNA ligase,</p><p> and 6.95μl ddH2O. The LDR conditions included initial denature at 95°C for 2 minutes, followed by 35 cycles of denature at 94°C for 30 seconds, and annealing at</p><p>60°C for 2 minutes. LDR products (1μl) were mixed with 1μl ROX (ABI, Foster City,</p><p>CA, USA) and 1μl loading buffer, detected in ABI PRISM 377 DNA Sequencer, and analyzed with Genemapper (ABI, Foster City, CA, USA)</p><p>3 Table S1. Clinical characteristics of IAs and controls in the first study</p><p>Aneurismal Patients n (%) Controls n (%) P Value Total 298 488 Age, years Mean (SD) 51.3 (11.1) 52.0 (11.0) NS Sex (M/F) 119/179 188/300 NS Hypertension 194/298(65.1) 62/488(12.7) <0.001 Smoking 65/298(21.8) 93/488(19.1) NS Male 60/119(50.4) 89/188(47.3) NS Female 5/179(2.8) 4/300(1.3) NS Alcohol consumption 69/298(23.2) 115/488(23.1) NS Ruptured IAs 271/298, (90.9) Multiple IAs 21/298(7.1) Site of IAs: ICA, PCoA 128/298(43.0) ACoA 91/298(30.5) MCA 37/298(12.4) ACA 13/298(4.4) PCA 11/298(3.7) Other 18/298(6.0)</p><p>SD indicates standard deviation; M, male; F, female; IAs, intracranial aneurysms;</p><p>ICA, internal carotid artery; PCoA, posterior communicating artery; ACoA, anterior</p><p> communicating artery; MCA, middle cerebral artery; ACA, anterior cerebral artery;</p><p>PCA, post cerebral artery; n, the number of the recruited subjects; NS, non-</p><p> significance. P Chi-square test or student t test</p><p>Table S2. Clinical characteristics of IAs and controls in the second study</p><p>4 Aneurismal Patients n (%) Controls n (%) P Value Total 192 1690 Age, years Mean (SD) 51.9 (12.8) 59.6 (8.5) <0.001 Sex (M/F) 89/103 701/989 NS Hypertension 92/192(47.9) 456/1690(27.0) <0.001 Smoking 56/192(29.2) 452/1690(26.7) NS Male 44/89(49.4) 396/701(56.5) NS Female 12/103(11.7) 56/989(5.7) 0.017 Alcohol consumption 57/192(29.7) 426/1690(25.2) NS Ruptured IAs 79/192(41.1) Multiple IAs 38/192(19.8) Site of IAs: ICA, PCoA 104/192(54.2) ACoA 21/192(10.9) MCA 14/192(7.3) ACA 11/192(5.7) PCA 3/192(1.6) Other 39/192(20.3)</p><p>SD indicates standard deviation; M, male; F, female; IAs, intracranial aneurysms;</p><p>ICA, internal carotid artery; PCoA, posterior communicating artery; ACoA, anterior</p><p> communicating artery; MCA, middle cerebral artery; ACA, anterior cerebral artery;</p><p>PCA, post cerebral artery; n, the number of the recruited subjects; NS, non-</p><p> significance. P Chi-square test or student t test</p><p>Table S3: Baseline characteristics of the subjects in the third study</p><p>Controls Hypertension Hemorrhage P P (n=1883) (n=1074) (n=633) Age, years 59.55±8.55 59.64±8.12 0.612 58.44±9.70 0.01</p><p>5 Men, % 57.7 52.1 0.003 60.5 0.22</p><p>BMI, kg/m2 24.2±3.3 24.3±3.6 0.433 24.0±3.5 0.519</p><p>SBP, mm Hg 134.43±29.81 167.95±22.41 0.000 173.48±44.87 0.000</p><p>DBP, mm Hg 82.89±17.34 98.80±11.37 0.000 99.34±31.09 0.000</p><p>TC, mmol/L 5.16±1.27 5.54±1.14 0.712 4.89±1.23 0.155</p><p>TG, mmol/L 1.58±1.22 1.84±1.84 0.061 1.65±1.09 0.173</p><p>Glucose, mmol/L 5.67±1.79 5.59±1.79 0.801 6.25±2.23 0.000</p><p>Cigarette smoking, % 0.000 0.000</p><p>Never 56.7 20.8 39.3</p><p>Former 19.8 69.9 36.1</p><p>Current 23.4 9.3 24.5</p><p>Alcohol intake, % 0.000 0.000</p><p>Nondrinker 62.2 26.4 43.9</p><p>Drinker 37.8 73.6 56.1</p><p>Hypertension history, % 0 100 0.000 81.3 0.000</p><p>DM history, % 5.5 5.5 0.625 6.8 0.251 Age, body mass index (BMI), Systolic (SBP) and diastolic (DBP) blood pressure, glucose, and TC values are given as mean (± SD); TG values as median (range), and other values, as number of individuals (n) with percentage (n/N) in parentheses. DM indicates diabetes mellitus. Body mass index is calculated as the weight in kilograms divided by body surface area (square meter). TC indicates total cholesterol; TG, triglycerides</p><p>6 Table S4. Primer and Probe Sequence and PCR and LDR Product Length of 3 Variants</p><p> variants Primer or Probe Sequence(5’-3’) PCR or LDR length rs2138533-up TGTGTACAGGACAAAGATGTCTGA 111 rs2138533-low TGTTGAGAATGGTCATGAATATAAGC rs2138533C/T rs2138533_modify P-GATGCTGGGGAAAGGCTGTTATATGTTTTTTTTTTTTTT-FAM rs2138533_C TTTTTTTTTTTTTTAGCTTTTCTACTGGATCACAGTAGG 78 rs2138533_T TTTTTTTTTTTTTTTTAGCTTTTCTACTGGATCACAGTAGA 80 rs11887092-up CCATTCTCAACAGTTACTTTTCTCC 145 rs11887092-low CACAAACCAAGACATCTCAATG rs11887092A/G rs11887092_modify P-TGGAGAGTCACTGCTTGGGGGCGTGTTTTTTTTTTTTTTTT-FAM rs11887092_A TTTTTTTTTTTTTTTTCCTCTTGTGTATCTTTATTTTAGAT 82 rs11887092_G TTTTTTTTTTTTTTTTTTCCTCTTGTGTATCTTTATTTTAGAC 84 rs1800255-up ACGTGGACCTCCTGGATTG 170 rs1800255-low GCAGCACCCTGAAAATAAGTG rs1800255G/A rs1800255_modify P-TCCACCTCTAAGTCCTGGGGCCCCTTTTTTTTTTTTTTTTTTT-FAM rs1800255_A TTTTTTTTTTTTTTTTTTCTCCTTCGGGACCAGGGGGACCAGT 86 rs1800255_G TTTTTTTTTTTTTTTTTTTTCTCCTTCGGGACCAGGGGGACCAGC 88</p><p>PCR, polymerase chain reaction; LDR, ligase detection reaction.</p><p>7 Table S5. The results of LD analysis in the promoter region.</p><p>Tag SNP SNP in block r2 rs2138533 rs1878199 0.954</p><p> rs1878200 0.949</p><p> rs6434304 0.815</p><p> rs5434305 0.954 rs11887092 rs3806465 1.0</p><p> rs12469508 0.924</p><p> rs11894810 1.0</p><p> rs2351419 1.0</p><p> rs12477499 0.92</p><p>8 Table S6. Statistic Power in the Dominant Model</p><p>Power IAs-Controls IAs-Controls Hypertension- Hemorrhage- Variants (First study) (Second study) Controls Controls rs2138533 0.75 0.73 0.99 0.99 rs11887092 0.68 0.63 0.99 0.96 rs1800255 0.77 0.75 0.99 0.99 According to the dominant model, the statistical power in the first and second study was more than 73%, detecting an association at P=0.05 with a relative risk of 1.5 for alleles at 11–37% frequency with the exception of rs11887092. The power was more than 96% in the third study (Controls-Hypertension-Hemorrhage).</p><p>9</p>
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages9 Page
-
File Size-