Upregulation of Dickkopf1 by Oscillatory Shear Stress Accelerates Atherogenesis

Upregulation of Dickkopf1 by Oscillatory Shear Stress Accelerates Atherogenesis

<p> ELECTRONIC SUPPLEMENTARY MATERIAL ESM, J Mol Med</p><p>Upregulation of Dickkopf1 by oscillatory shear stress accelerates atherogenesis</p><p>Mengmeng Li, Xinxin Liu, Yu Zhang, Mingxue Di, Han Wang, Lin Wang, Yifei Chen, Xiaoling Liu, Xiaoqing Cao, Renya Zeng, Yun Zhang, Mei Zhang#</p><p>The Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Qilu Hospital of Shandong University, Jinan, China, 250012</p><p>Running title: DKK1 and atherosclerosis</p><p># Send Correspondence and Reprint Requests to: Mei Zhang Department of Cardiology Qilu Hospital, Shandong University 107#, Wen Hua Xi Road, Jinan, Shandong, 250012, P.R. China Phone: 86-0531-82169139 Fax: 86-0531-86169356 E-mail: [email protected]</p><p>1 Table S1. Antibodies used in this study</p><p>Primary Host Dilution and supplier Application antibodies DKK1 Mouse 1:500 for WB, 1:50 for IF, 1:200 for IHC; WB, IF, Abcam, Cambridge, MA IHC CD31 Rat 1:50; Santa Cruz, Dallas, TX IF VCAM1 Rabbit 1:1000; Abcam, Cambridge, MA WB ICAM1 Rabbit 1:1000; Abcam, Cambridge, MA WB E-selectin Rabbit 1:500; ProteinTech Group, Chicago, IL WB ZO1 Rabbit 1:1000 for WB, 1:50 for IF; ProteinTech WB, IF Group, Chicago, IL ZO2 Rabbit 1:1000 for WB, 1:100 for IF; Cell Signaling, WB, IF Danvers, MA Occludin Rabbit 1:1000 for WB, 1:100 for IF; Abcam, WB, IF Cambridge, MA Claudin 5 Rabbit 1:500 for WB, 1:50 for IF; Abcam, WB, IF Cambridge, MA MOMA-2 Rat 1:50; Abcam, Cambridge, MA IF PAR1 Rabbit 1:300; Abcam, Cambridge, MA WB CREB Rabbit 1:1000; Cell Signaling, Danvers, MA WB p-CREB (Ser 133) Rabbit 1:1000; Abcam, Cambridge, MA WB α-SMA Rabbit 1:100; Abcam, Cambridge, MA IHC</p><p>β-catenin Rabbit 1:1000; Cell Signaling, Danvers, MA WB</p><p> p-β-catenin Rabbit 1:1000; Cell Signaling, Danvers, MA WB</p><p>Table S2. Primer pairs of the target genes used for real time RT-PCR in this study</p><p>Genes Forward Reverse Homo DKK1 GGGAATTACTGCAAAAATGGAATA ATGACCGGAGACAAACCAGAAC Homo PAR1 GTTGATCGTTTCCACGGTCT ACGCAGAGGAGGTAAGCAAA</p><p>2 Homo β-actin CGTGCGTGACATTAAGGAGA CACCTTCACCGTTCCAGTTT Mus DKK1 CTCATCAATTCCAACGCGATCA GCCCTCATAGAGAACTCCCG Mus β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT</p><p>3 Fig. S1 Partial ligation of left common carotid artery (LCA) caused disturbed flow in mice. (a) Ultrasound images showing flow velocity profiles pre-ligation and 1 day post- ligation and revealing that partial ligation induced flow reversal (indicated by red arrows) in the LCA during diastole. Flow in the right common carotid artery (RCA) remained unchanged after ligation. (b) Partial ligation reduced blood flow through the LCA, without significantly raising flow in RCA. * P<0.05 vs. pre-ligated mice (n=8). (c) Western blot analysis of protein levels of mechanosensitive proteins VCAM1 and ICAM1 at 2 days after ligation in LCA of sham and ligated groups. * P<0.05 vs. sham-operated mice (n=8).</p><p>4 Fig. S2 In vivo gene silencing of DKK1 by caudal vein lentiviral gene delivery in</p><p>ApoE-/- mice. (a) Representative fluorescent photomicrographs for the left common carotid artery 2 weeks after pGLV3-shRNA-DKK1 delivered into mice. (b) Immunostaining of the left common carotid artery 2 weeks after pGLV3-shRNA-DKK1 delivered into mice, showing the efficiency of lentiviral delivery. </p><p>5 Fig. S3 DKK1 expression in vascular smooth muscle cells (VSMC) under disturbed flow showed no significant change. (a) Immunostaining of α-SMA (VSMC marker) and DKK1 on serial cross-sections. Black arrows refer to endothelium and black stars to VSMC. (b) Western blot analysis of DKK1 protein expression under oscillatory shear stress (OSS) for 6 h in HUVEC and VSMC. * P<0.05 vs static control (Con) (n=6).</p><p>6 Fig. S4 DKK1 negatively regulated Wnt/β-catenin pathway in vitro. Western blot analysis of the expression of phosphorylated and total β-catenin in HUVECs transfected with DKK1 siRNA. * P<0.05 vs. control without treatment and # P<0.05 vs. only OSS treatment (n=6).</p><p>7</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    7 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us