Translation Activity Georgia Version

Translation Activity Georgia Version

<p>Name ______Date ______Period ______Translation Activity – Georgia Version Proteins are very important in living organisms. To make a protein, our cells first transcribe a gene (from DNA) into an RNA molecule, and then translate the RNA message into a sequence of amino acids.</p><p>The process of producing a protein is as follows: First, the DNA “unzips” and is copied as mRNA (a process called transcription).</p><p>Next, this message leaves the nucleus in search of a ribosome (the site of protein synthesis). This mRNA feeds into the ribosome and then is decoded into sets of three (translation).</p><p>How is it translated? A codon is a set of 3 nitrogen bases on the mRNA. The matching anti-codon from the tRNA locks in to the codon. The tRNA is attached to specific amino acid. As amino acids link together, a protein (polypeptide) forms.</p><p>PROCEDURE: Below are several mRNA messages. Translate them to the proper tRNA sequences and then use the decoder chart to find the proper letter sequence. In the practice set the letters will represent amino acids. Finally, translate the messages into real amino acid sequences using the real genetic code chart. 1. mRNA: AAGACCAUGAAAGUCACCAAAAACCUCAAGGCCUACACGAUU tRNA:</p><p>Practice message:</p><p>Real message:</p><p>2. mRNA : AGGUACUUACUCAGGGGUAAGUUAGUCGUGCCGGUGGGAGUCUAUACU tRNA:</p><p>Practice message:</p><p>Real message:</p><p>3. mRNA: UUGAUGCCAGUAUUUGGUGAUGACGGUACCCCGAUC tRNA:</p><p>Practice message: Name ______Date ______Period ______4. mRNA: UUACGGUACCACUACGUCUUGCGUUACUACACGUCGAAAGUGUUCAUC tRNA:</p><p>Practice message:</p><p>5. mRNA : GUGAAAACGACCUACCUUACAAGGUUAAUGCACACCUUAGCACUCGUCAAAGUGUACGUUACCAUU</p><p>Practice message:</p><p>6. mRNA: AACCUCAAAACAACGACCUUAUCAGUUAAUAAAAUGUAAAUC tRNA:</p><p>Practice message:</p><p>7. mRNA: ACGACCUUGGUUUACGUAUUAGCGGUUACCAAAGGAGUUACU tRNA:</p><p>Practice message:</p><p>8. This message represents message #7 with a problem. What is the problem? mRNA: ACGACUUGGUUUACGUAUUAGCGGUUACCAAAGGAGUUACU tRNA:</p><p>Practice message:</p><p>ANALYSIS 1. How did the problem affect the sense of the letter sequence?</p><p>2. How did it affect the amino acid sequence?</p><p>3. Where could the problem occur and not dramatically affect the protein being made?</p><p>4. What if you simply substituted a “C” for the 5th tRNA nucleotide in message #7? How would the substitution affect the protein? Name ______Date ______Period ______</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    3 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us