<p>Table S1 Primers and amplicons for determination of TYRP1 coding sequence from genomic DNA.</p><p>TYRP1 exon Exon size Amplicon size Forward and reverse primers (5’-3’) Tm (oC) 2 435 795 F: TTAAAGGTGGGTGGGAAGG 64</p><p>R: TAAAGTGGCTGCTCCACAAG 3 323 736 F: GGGGTGAAGAAGGGATTTTG 55</p><p>R: CTCAGTTGGCTTCCTCATCAC 4 205 549 F: ACCACAGCTCACCAAAATGC 66</p><p>R: ATCACCTTAGGTTGCCCAGAC 5 168 974 F: CCCTGAGGCAACCAAGTATCC 65</p><p>R: GACAGGCTCAACATGGCATTC 6 180 774 F: CATGTAGACCAGTGTTAGCCTTG 63</p><p>R: CTTACAGGAACGTGGTAGTCATC 7 147 607 F: TCCCTGTTCTGCTGCTGTG 63</p><p>R: CATTTACTCCCTCTAAGCCTCATC 8 401 745 F: GAAAGACCTGGGCTCCAAAAC 65</p><p>R: GGTGCCACCCATCATTCTAAAG Table S2 Seven TYRP1 exonic mutations in 16 domestic pig breeds and wild pigs.</p><p>Breed Colour Exonic mutation site</p><p>2 2 2 2 3 3 3</p><p>-19 22 49 144 477 525 685</p><p>Chinese wild pig Wild type C T C G C C C</p><p>European wild pig Wild type C T C G C C C</p><p>Tibetan Reddish or silver brown C/T T/A C/A G/A C C/T C/T</p><p>Tibetan Black C T C G C C/T C</p><p>Kele Dark or pale brown C T C G C C C</p><p>Kele Black C T C G C C C</p><p>Dahe Yellow brown C T C G C C/T C</p><p>Dianan Small-Ear Black C T C G C/T C/T C</p><p>Duroc Red C T C G C C C</p><p>Erhualian Black C T C G C C C</p><p>Hampshire White belt and black body C T C G C C C</p><p>Hetao Large-Ear Black C T C G C C C</p><p>Jinhua Two-end-black C T C G C C C</p><p>Laiwu Black C/T T/A C/A G/A C C C/T</p><p>Landrace White C T C G C C C</p><p>Large White White C T C G C C C</p><p>Luchuan Black with white belly C T C G C C</p><p>Pietrain Spotted C T C G C C C</p><p>Rongchang White C T C G C/T C/T C</p><p>Yushan Black C T C G C C C</p><p>Wuzhishan Black with white belly C T C G C C C Table S3 Allele frequencies at the TYRP1 c.428G>A polymorphic site</p><p>(p.143His>Arg) in Chinese and European pig breeds.</p><p>Breed Coat colour No. Allele frequency</p><p>G A Chinese breed</p><p>Dahe Black, yellow or silver brown 43 0.244 0.756</p><p>Dianan Small-Ear Black 30 0.717 0.283</p><p>Erhualian Black 32 0.656 0.344</p><p>Hetao Large-Ear Black 32 0.828 0.172</p><p>Jinhua Two-end-black 33 0.985 0.015</p><p>Kele Black 60 0.600 0.400</p><p>Kele Dark or pale brown 29 0.172 0.828</p><p>Laiwu Black 32 0.641 0.359</p><p>Luchuan Black with white belly 33 1.000 0.000</p><p>New Dahe Black 43 0.244 0.756</p><p>Rongchang White 35 0.986 0.014</p><p>Tibetan Reddish or silver brown 54 0.463 0.537</p><p>Tibetan Black 105 0.910 0.090</p><p>Yushan Black 29 0.793 0.207</p><p>Wuzhishan Black with white belly 32 0.719 0.281</p><p>Wild boars Wild type 67 0.612 0.388</p><p>European breed</p><p>Duroc Red 61 0.189 0.811</p><p>Hampshire White belt and black body 41 0.317 0.683</p><p>Iberian Black 10 0.650 0.350</p><p>Landrace White 39 0.115 0.885</p><p>Large White White 62 0.403 0.597</p><p>Pietrain Spotted 23 0.261 0.739</p><p>Wild boars Wild type 11 0.364 0.636 Table S4 Epistasis relationships for TYRP1 and MC1R in Kele and Dahe pigs.</p><p>Breed Genotype No. Phenotype TYRP1 MC1R Kele +/+ ED1/ED1 17 Solid black +/+ ED1/ED2 4 Solid black +/+ ED1/e 1 Solid black +/del ED1/ED1 20 Dark brown +/del ED1/ED2 4 Dark brown del/del ED1/ED1 2 Pale brown Dahe +/+ ED1/ED1 1 Solid black +/del ED1/ED1 9 Black brown (n = 7); Yellow brown (n = 1); Silver brown (n = 1) +/del ED1/ED2 4 Black brown (n = 3); Silver brown (n = 1) +/del ED1/EP 2 Yellow brown del/del ED1/ED1 5 Yellow brown (n = 3); Silver brown (n = 2) The nomenclature for these MC1R alleles has been described in Reference Fang et al. (2009) Figure S1. Four families segregating for the brown coat colour in Tibetan pigs.</p><p>Circles represent females, squares represent males, black symbols indicate black pigs and red symbols indicate brown coated pigs. Figure S2. Genotype patterns at the TYRP1 c.1484_1489del and c.428G>A mutation sites. (A) The electrophoresis patterns of the TYRP1 c.1484_1489del mutation by a KpnI PCR-RFLP assay. Line 1: del/del. Lines 2, 8, 9: +/+. Lines 3-7,</p><p>10: +/del. (B) The electropherograms for the TYRP1 c.428G>A polymorphism by the</p><p>SNaPshot analysis. Figure S3. The TYRP1 c.1484_1489del mutation and multispecies alignment of the TYRP1 protein sequences. (A) Representative electropherograms for the TYRP1 c.1484_1489del mutation from a wild type (+/+), a heterozygote (+/del) and a homozygous mutant (del/del) pig. (B) Multispecies alignment of the TYRP1 protein sequence around the deletion. The sequences for the alignment were taken from the following accessions: NP_001020397 (pig), GU345799 (pig), NP_112479 (mouse),</p><p>NP_001100134 (rat), NP_776905 (cattle), NP_001075309 (horse), NP_001036025</p><p>(cat), XP_864543 (dog), NP_000541 (human), XP_520488 (chimpanzee),</p><p>XP_001111475 (rhesus monkey), NP_001123495 (sheep), NP_990376 (chicken),</p><p>NP_001080492 (frog). The horizontal line indicates the transmenbrane domain of the protein. </p>