The Following Supplement Accompanies the Article

The Following Supplement Accompanies the Article

<p> Supplement</p><p>Supplementary table 1 Descriptive statistics of the recorded growth traits for three goat breeds</p><p>Breeds (n) traits Mean SE Min Max BE (81) BH (cm) 66.41 0.63 57.00 88.00 BL (cm) 79.59 1.21 58.00 150.00 CaC (cm) 10.48 0.16 6.50 14.00 ChC (cm) 85.54 1.28 50.00 109.00 BW (kg) 55.31 1.97 57.82 125.35 XH (213) BH (cm) 61.69 0.51 42.00 76.00 BL (cm) 75.11 1.10 44.00 146.00 CaC (cm) 8.99 0.09 6.50 13.00 ChC (cm) 75.42 0.86 49.00 99.00 BW (kg) 42.09 1.30 50.19 119.45 HM (136) BH (cm) 54.19 0.41 45.00 66.00 BL (cm) 99.17 1.17 59.00 129.00 CaC (cm) 7.53 0.08 6.00 10.00 ChC (cm) 66.99 0.60 52.00 93.00 BW (kg) 41.91 1.03 34.77 95.30 XH = Xuhuai goat; BE = Boer goat; HM = Haimen goat; BH = Body height; BL = Body length; CaC = Cannon circumference; ChC = Chest circumference; BW = Body weight; N = Number of observations; Mean = Means of traits; SE = Standard error; Min and Max = Minimum and maximum values. Supplementary table 2 The characteristics of the primers in present study</p><p>Primers Primer sequences Length of products Annealing Position temperatures (°C) G1 5' CAGTTGCCAAGAATGAG 3' 452 bp 52 Exon1 5' CTCTTTAAGTGCACATGC 3' G2 5' TGAAGACAGTGTGGCGAT 3' 350 bp 57 Exon2 5' TGAAGACAGTGTGGCGAT 3' G3 5' TTCTTTCACAGACAGCCTCT 3' 340 bp 56 Exon3 5' TACTCTTTACCACGTCCCAT 3' G4 5' TCCAACTGGTAACCGTGCT 3' 303 bp 54 Exon4 5' CCGCCTCCTTCTCTGCTCT 3' G5 5' GCTTCTTATCCTCCAGTTC 3' 429 bp 57 Exon5 5' TCTCAGGTCAGTCCCAGT 3' G6 5' GGTTTTCCCTCTATTTCC 3' 294 bp 55 Exon6 5' GCTTTCCTCTGTGGTTCC 3' G7 5' TTTTGTCTCTGTCCCTGCC 3' 297 bp 58 Exon7 5' GTGTTTGCTTCTGAGCTGG 3' G8 5' GTCCCCCTCTATCTCCTCGC 3' 310 bp 55 Exon8 5' GTCATAAAGCCCCCGCCA 3' G9 5' CGTGGAGCCTTTAGGACTT 3' 356 bp 59 Exon9 5' ACGGTTCTGGTTCTTGGAG 3' G10 5' ACTTTTGTTCCTTGGTTTTGA 3' 350 bp 55 Exon10 5' ATTCTCTATTTCCACCCCCT 3' G11 5' CATAATGAAGAGCCACAA 3' 406 bp 54 Exon11 5' ACAATCAAGAAGGAAAGC 3' G12 5' CCCTGGTGGTCAGTCTTCA 3' 289 bp 57 Exon12 5' GGGGCTTTAGGGGGTAGA 3' G13 5'TCAAGATGGAGATGCCAGGACAG 3' 349 bp 65 Exon13 5'CGGGAGGAGCTATGAGAAAGGTT 3' G14 5' GGTGCTAACCAGGTGACAA 3' 293 bp 56 Exon13 5' GCATAACCGCAAGGAATT 3' </p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    3 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us