Mutations: the Effect on Phenotype

Mutations: the Effect on Phenotype

GROUP I MUTATIONS: ASSESSMENT QUESTIONS/CHALLENGES THE BASICS: Transcription and Translation 1. Which event happens first, translation or transcription?

2. What would you say is the general purpose of transcription?

3. What would you say is the general purpose of translation?

4. Which illustrates the correct order? a. RNA  amino acid  DNA b. Amino acid  DNA  RNA c. DNA  amino acid  RNA d. DNA  RNA  amino acid

5. There are some rules about how nucleotides pair with one another. Show that you know the rules by completing the table that appears below:

DNA (A,T,C,G) …Transcription… RNA (A,U,C,G) U=Uracil Adenine (A) Pairs with   Thymine (T) Pairs with   Cytosine (C) Pairs with   Guanine (G) Pairs with  

6. Support this statement by completing the table: “A DNA change (Mutation) does NOT always cause a change in the amino acid.” Sometimes a mutation… Sometimes a mutation… does not change the amino acid. does change the amino acid. DNA RNA AA

Example for Students: Sometimes a mutation… Sometimes a mutation… does not change the amino acid. does change the amino acid. DNA GCA GCT ACC AGC RNA CGU CGA UGG UCG AA Arginine Arginine Tryptophan Serine

PERFORMANCE ASSESSMENT: AMINO ACID BINGO 7. Play a round of AMINO ACID BINGO to demonstrate your transcription and translation abilities!  MATERIALS: http://www.woodrow.org/teachers/bi/1994/codon_bingo.html o Full instructions and printable materials are found at this website.  CUSTOMIZED BINGO CARDS: http://www.teach-nology.com/web_tools/materials/bingo/5/ o Teachers or students can easily/quickly make customized amino acid bingo cards at this website.  TRANSCRIPTION AND TRANSLATION SIMULATION: http://learn.genetics.utah.edu/content/begin/dna/transcribe/ o This simulation could be used after playing amino acid bingo for closure. THE DETAILS: PTC - Transcription and Translation 1. What is the PTC receptor made out of? a. DNA b. RNA c. Protein

2. The PTC receptor is found on an organism’s tongue and is connected to the organism’s… a. Food b. Nose c. Brain d. Stomach

3. This question is about the importance of the PTC protein receptor’s three-dimensional shape. You will be asked to draw two pictures and briefly explain what you have drawn. Both pictures will have the PTC Protein Receptor and the PTC Molecule and the Brain.

Human Taster Human Non-Taster

Brief Explanation: Brief Explanation:

4. Let’s think more about the two drawings you just created: How is it possible that mutations in certain locations within PTC gene (nucleotide positions 145, 785 and 886) affect tasting the PTC molecule but mutations in other regions of the PTC gene might not affect tasting PTC? You may answer this question using words or labeled drawings with brief explanations.

5. In the table that appears below you will see two columns: Claims and Evidence. I have already filled in the claim for you. Your job is to provide DNA evidence from the activity that supports this claim. CLAIM: EVIDENCE:

Humans have evolved to be non-tasters. GROUP II

THE DETAILS: PTC - Transcription and Translation 6. What is the PTC receptor made out of? a. DNA b. RNA c. Protein

7. The PTC receptor is found on an organism’s tongue and is connected to the organism’s… a. Food b. Nose c. Brain d. Stomach

8. This question is about the importance of the PTC protein receptor’s three-dimensional shape. You will be asked to draw two pictures and briefly explain what you have drawn. Both pictures will have the PTC Protein Receptor and the PTC Molecule and the Brain.

Human Taster Human Non-Taster

Brief Explanation: Brief Explanation:

9. Let’s think more about the two drawings you just created: How is it possible that mutations in certain locations within PTC gene (nucleotide positions 145, 785 and 886) affect tasting the PTC molecule but mutations in other regions of the PTC gene might not affect tasting PTC? You may answer this question using words or labeled drawings with brief explanations.

10. In the table that appears below you will see two columns: Claims and Evidence. I have already filled in the claim for you. Your job is to provide DNA evidence from the activity that supports this claim. CLAIM: EVIDENCE:

Humans have evolved to be non-tasters. Assessment of PTC Unit - Activity #1: Taster vs. Non Taster  Opening Journal Question, “Why do we taste?”

 Class Discussion (formative Assessments)

 Exit Ticket “Anonymous Questions about Activity”

 Worksheets 1 + 2 would be given a check plus, check, check minus.

 #1 I pairs #2 pairs/finish HW

*Journals- are checked weekly/biweekly for a quiz grade *Modification for #2: silent sort of DNA/RNA/AA  Review Questions

Activity #2  Journal question: “Is there a relationship between mutations & evolution?”

 Worksheet would be given a check plus, check, check minus.

 Class discussions: (1) what info do you need? (2) Construct #4

 Homework: Make a concept map using no more than 10 terms & would be given a CP, C, CM. Concept maps would be discussed via “elmo”

 Exit ticket: Explain/ list 3 things that you have learned based on concepts/terms we have discussed.

Lab:  Check list as students are doing the lab (Construct #1)

 Asking questions (index cards?)

“Why are you doing this?”, etc. GROUP III

Lab Report Conclusion and Analysis Part I 1. Using the data gathered in the lab explain the percentage of tasters and nontasters.

2. Does this support Mendel’s Law of Dominance?

Part II 1. Describe the DNA at different stages of the lab:

A. before centrifuging

B. After centrifuging

2. Describe the components of PCR.

3. What is happening in the thermocycler?

4. What is formed in the microtube after thermocycling?

Part III

1. What is the job of a restriction enzyme?

2. How is this substance used to show the difference between tasters and nontasters?

3. In viewing the results of the electrophoresis draw the position/location of your DNA and your partners.

4. State the genotype for you and your partner. GROUP IV

Summative Assessment: The Effect Of Phenotype Quiz

A. From the following DNA sequence, transcribe the information for a mRNA strand.

AAGCATACGTTAAGGCGAGTAATA

B. From the above resulting mRNA strand, translate the codons into its corresponding amino acid using the genetic code table supplied.

C. If you change the third nucleotide to its corresponding base pair in the mRNA sequence for each codon (select the codons from your mRNA strand), will they result in being coded for a particular amino acid or a different amino acid? Explain using the genetic code table for supportive evidence.

D. Why would it be beneficial to have the ability to taste PTC? What could be the evolutionary advantage?

E. Could it be harmful to not be able to taste PTC? Why? Show supportive evidence.

Summative Assessment: Mutations: Genetic Variations Over Time

Short Essay Haplotype Human Taster Human Nontaster Primate taster Primate Non taster 145 CCA GCA CCA GCA

785 GCT GTT GCT GTT

886 GTC ATC GTC ATC

In the proceeding class discussion, 3 nucleotides positions (a haplotype) were found to show the presence of Non –tasters and Tasters of PTC. If humans at 145 bp show production of CCA, can primates showing the production of proline at 145 bp be able to taste PTC? Explain.

Formative Assessment: Laboratory (First session)

Please hand in your PTC homework given yesterday in class.

I. Write a do now with questions from the PTC protocol to be done today in Lab.

A. Why did you rinse your mouth with saline solution? (to acquire cheek cells) B. Why do we use a centrifuge?

C. Where will you find your DNA? In the pellet or the supernatant?

D. What is the purpose of Chelex? (binds the polar cellular components leaving the non polar components in the water above the Chelex) II. Laboratory Techniques

A. Why would we boil the solution after adding 30 ul of Chelex? (further rupture of the cell membranes) B. Why do we freeze the solution? (to suspend the chemical activity and the DNA keeps better in frozen state)

C. Why do we add primer/dye to the PCR beads?

D. What type of “scissors” did we use to cut out the target sequence area?

E. Why is it necessary to heat the Hae III solution to 37C ? GROUP IV

PTC TESTING LAB – Inquiry Activity

Pre Assessment: Questions: What is PTC? How do we taste? Why do we Taste? Why are there Tasters vs. Non-tasters

Performance Task: Lab Component Analysis of Digital Gel Photos Science Inquiry Monitoring Chart Formative Assessment: Journal (not Graded)  What did you learn in class today? Interview: teacher asks student questions about procedural steps and the reasoning. Why Primers, enzymes purpose…. Self Assessment: Exit Ticket – rate your team’s performance Observing student performance: teacher monitoring chart Rough Draft Review

Summative Assessment: Work Packet (provided by ARISE) Formal Lab Write-up Lab Quiz Assessment of Inquiry (Science Inquiry Constructs Rubric)

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    8 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us