<p>Table S1 Primer sets used for the PCR amplification of apple virus Virus Primer name Sequence 5′-3′ Position (nt) Size (bp) References ACLSV A52 CAGACCCTTATTGAAGTCGAA 7232-7212 358 [4] A53 GGCAACCCTGGAACAGA 6875-6891 ACF1 TGGAGTCCATCTTCGCGAAC 6913-6922 590 [10] ACR1 CTCTTTCATGGGTTCAAGAG 7522-7503 ASGV C6396 CTGCAAGACCGCGACCAAGTTT 6393-6396 524 [5] H5873 CCCGCTGTTGGATTTGATACACCTC 5872-5896 AGF1 ATGAGTTTGGAAGACGTGC 5640-5658 713 [10] AGR1 GACTAACCCTCCAGTTCC 6338-6353 ASSVd AS1 CCGGCCTTCGTCGACGACGA 101-82 330 [29] AS3 TGAGAAAGGAGCTGCCAGCAC 102-122 ASSVd1 CCGGATCCGGTAAACACCGTGCGGTCCC 1-28 330 This study ASSVd2 CCGGATCCGGGAAACACCTATTGTGTTT 203-231 ASPV ASP-C CTCTTGAACCAGCTGATGGC 8993-9012 264 [14] ASP-A ATAGCCGCCCCGGTTAGGTT 9237-9256 ASPV-3A AGCGGTTGCCTATTTTTGCTCC 3480-3501 291 [19] ASPV-3B GTGAGGTCAAAGATGCTGAAACC 3748-3770 ASPV-cpF GCGATCTATGTTTCCGAGAAGTGG 7622-7648 1643 This study ASPV-cpR CCTGTTAGGTTGGGATCAACT 9244-9264 ASPV-tgbF ACTCCCCAAGAGGTGGATGCTCATTACAA 6469-6479 1394 ASPV-tgbR ACTACACCCTAACCTAATGGG 7841-7862</p><p>Table S2 Prevalence and distribution of ACLSV, ASGV, ASPV and ASSVd in apples from China</p><p>Origin ASPV ASGV ACLSV ASSVd C/A 3A/3B C/A + C6396/ U/2 C6396/H5 A52/53 ACF1/ A52/53 + AS1/AS d1/ d2 AS1/AS3 3A/3B H5873 873 + U/2 R1 A52/53 3 + d1/ d2 Liaoning 38.2 5.9 41.2 55.9 47.1 61.8 70.6 2.9 70.6 35.3 29.4 41.2 (13/34) (2/34) (14/34) (19/34) (16/34) (21/34) (24/34) (1/34) (24/34) (12/34) (10/34) (14/34) Shanxi 0 0 0 40.0 40.0 40.0 0 0 0 0 0 0 (0/5) (0/5) (0/5) (2/5) (2/5) (2/5) (0/5) (0/5) (0/5) (0/5) (0/5) (0/5) Shandong 62.7 65.7 71.6 65.7 68.7 73.1 59.7 3.0 59.7 7.5 3.0 9.0 (6/67) (42/67) (44/67) (48/67) (44/67) (46/67) (49/67) (40/67) (2/67) (40/67) (5/67) (2/67) Henna 54.2 16.7 66.7 75.0 70.8 79.2 75.0 8.3 75.0 16.7 8.3 25.0 (13/24) (4/24) (16/24) (18/24) (17/24) (19/24) (18/24) (2/24) (18/24) (4/24) (2/24) (6/24) Hebei 36.4 18.2 36.4 9.1 18.2 18.2 9.1 0 9.1 (1/11) 0 18.2 18.2 (4/11) (2/11) (4/11) (1/11) (2/11) (2/11) (1/11) (0/11) (0/11) (2/11) (2/11) Total 51.1 36.9 58.2 59.6 58.9 66.0 58.9 3.5 58.9 14.9 11.3 19.9 (72/141) (52/141) (82/141) (84/141) (83/141) (93/141) (83/141) (5/141) (83/141) (21/141) (16/141) (28/141) Table S3 The GenBank accession numbers of Apple stem pitting virus isolates used for phylogenetic analysis Accession No. Ref. Isolates Host Species Cultivars* Origins CP gene TGBp1-3 gene 2CR Apple (leaf) Malus / Xingcheng, Liaoning, China KY081182 KY081146-47 This study domestica FS05 Apple (branch) M. domestica / Xingcheng, Liaoning, China KY081183 KY081150 This study FS05-1 Apple (branch) M. domestica / Linyi, Shangdong, China KY081184 KY081148-49 This study FS05-2 Apple (branch) M. domestica / Linyi, Shangdong, China / KY081151 This study FS05-3 Apple (branch) M. domestica / Linyi, Shangdong, China KY081185-87 KY081152 This study FS05-4 Apple (branch) M. domestica / Linyi, Shangdong, China KY081188 KY081153 This study FS06-2 Apple (branch) M. domestica / Linyi, Shangdong, China KY081189 KY081154 This study FS06-3 Apple (branch) M. domestica / Linyi, Shangdong, China KY081190-91 KY081155-56 This study FS06-4 Apple (branch) M. domestica / Linyi, Shangdong, China KY081192-93 / This study FS07 Apple (branch) M. domestica / Xingcheng, Liaoning, China KY081194 / This study FS07-2 Apple (branch) M. domestica / Linyi, Shangdong, China KY081195-96 / This study FS07-3 Apple (branch) M. domestica / Linyi, Shangdong, China KY081197 KY081157 This study FS07-4 Apple (branch) M. domestica / Linyi, Shangdong, China KY081198 KY081158 This study FS08-1 Apple (branch) M. domestica / Linyi, Shangdong, China KY081199 KY081159 This study FS08-2 Apple (branch) M. domestica / Linyi, Shangdong, China KY081200 KY081160 This study GMFS Apple (branch) M. domestica Gongmeifushi Weihai, Shangdong, China KY081201 KY081161 This study JM Apple (branch) M. domestica JM7 Weihai, Liaoning, China KY081202 / This study QY Apple (branch) M. domestica Qiuyue Shenzhou, Hebei, China KY081203 KY081162 This study TH2-5 Apple (branch) M. domestica Tianhong No. 2 Weihai, Shangdong, China KY081204 KY081163 This study TH2-8 Apple (branch) M. domestica Tianhong No. 2 Weihai, Shangdong, China KY081205 KY081164 This study X10 Apple (branch) M. domestica Xia Yantai, Shangdong, China KY081209-10 KY081165-66 This study X3 Apple (branch) M. domestica Xia Yantai, Shangdong, China KY081206 KY081167 This study X5 Apple (branch) M. domestica Xia Yantai, Shangdong, China KY081207-08 KY081168 This study X6 Apple (branch) M. domestica Xia Yantai, Shangdong, China / KY081169-70 This study X8 Apple (branch) M. domestica Xia Yantai, Shangdong, China / KY081171-72 This study XLF-A Apple (leaf) M. domestica / Sanmenxia, Henan, China KY081211 KY081175-76 This study XLF-B Apple (leaf) M. domestica / Sanmenxia, Henan, China KY081212 KY081173-74 This study XLF-C Apple (leaf) M. domestica / Sanmenxia, Henan, China KY081213-14 KY081177 This study YF8 Apple (branch) M. domestica Yanfu No.8 Weihai, Shangdong, China KY081215 KY081178 This study YSH1 Apple (branch) M. domestica SH Weihai, Shangdong, China KY081216 KY081179 This study YSH2 Apple (branch) M. domestica SH Weihai, Shangdong, China KY081217 KY081180 This study YSH8 Apple (branch) M. domestica SH Weihai, Shangdong, China KY081218 / This study YSH9 Apple (branch) M. domestica SH Weihai, Shangdong, China KY081219 KY081181 This study YSH10 Apple (branch) M. domestica SH Weihai, Shangdong, China KY081220 / This study IF38 Apple M. domestica / Japan AB045371 Yoshikawa, direct submission, 2000 Palampur Apple M. domestica / India FR694186 Dhir, direct submission, 2010 PA66 Pear Pyrus / Germany D21829 Jelkmann, 1994 communis KL1 Pear P. communis / China JF946775 Liu et al., 2012 KL9 Pear P. communis / China JF946772 Liu et al., 2012 PR1 Pear P. communis / China EU095327 Liu et al., 2012 ST54 Pear P. communis / Poland AF345892 Komorowska and Malinowski, direct submission, 2001 GNKVII/34 Pear P. communis / Poland AF345893 Komorowska and Malinowski, direct submission, 2001 *The names of the cultivars could not be recorded because they were originally gathered from different areas of China where they are named differently. / Nonexistence Table S4 Genetic distance between, and within, groups clustered into phylogenetic trees based on the ASPV CP and TGB1-3 gene sequences</p><p>Gene Between and within –group diversity (±SE) CP Gp I Gp II Gp III Gp I 0.24±0.01 Gp II 0.28±0.01 0.12±0.01 Gp III 0.38±0.02 0.38±0.02 0.06±0.01</p><p>TGB1 Gp I Gp II Gp I 0.21±0.01 Gp II 0.26±0.01 0.26±0.01</p><p>TGB2 Gp I Gp II Gp I 0.01±0.01 Gp II 0.19±0.02 0.14±0.02</p><p>TGB3 Gp I Gp II Gp I 0.16±0.01 Gp II 0.27±0.02 0.23±0.02</p>
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages7 Page
-
File Size-