Table 1 Malting Quality Traits of Mikamo Golden and Harrington

Table 1 Malting Quality Traits of Mikamo Golden and Harrington

<p>Supplementary material</p><p>Table S1 CAPS markers for genotyping QTLs of malt extract on 2H and 5H CAPS marker name primer sequence name CAPS-EX1 EX-1 CCTCAACTACACCCGTGCCATGTGTC EX-2 AAGCTATGTCCTTAAATGATTCCACGCCCC CAPS-EX2 EX-3 TGTAGTCAGTCACAGGTGTTATTCCAC EX-4 CGGGTTGAACTATGTCTATCTC Supplementary material</p><p>Table S2 Malt extracts and CAPS marker alleles of 33 world wide cultivars Cultivar 20001 2004 2005 2006 2008 2009 CAPS-EX12 CAPS-EX23 Haruna Nijo 84.3 82.2 85.2 83.9 Mi Mi Myogi Nijo 83.4 83.0 84.8 83.3 81.6 84.1 Mi Mi Tone Nijo 80.2 Mi Mi Sakitama Nijo 83.0 82.3 83.9 83.8 81.0 Mi Mi Sainohoshi 83.7 82.6 84.1 Mi Mi Golden Meron 80.7 78.0 80.7 81.0 77.4 80.1 Mi Hr Satsuki Nijo 77.8 82.2 Mi Hr Akagi Nijo 77.8 81.3 Mi Hr Hoshimasari 78.9 82.2 81.2 79.3 80.4 Mi Hr Ryofu 82.7 80.9 84.5 82.7 82.0 80.6 Mi Hr Hokuiku39 80.4 85.2 83.8 82.8 78.1 Mi Hr Betzes 82.1 78.2 82.8 81.9 81.3 79.5 Mi Hr CDC Reserve 81.9 Mi Hr Clipper 79.5 81.3 80.3 Mi Hr Schooner 81.5 78.4 80.8 80.9 79.7 78.6 Mi Hr Franklin 81.1 79.7 82.1 80.6 Mi Hr Lofty Nijo 82.4 80.0 81.3 81.8 82.3 80.1 Mi Hr Gairdner 78.8 80.3 79.5 81.2 79.0 Mi Hr Sloop SA 78.4 Mi Hr Prior 80.0 78.3 81.3 79.5 79.7 Mi Hr Hanna 76.7 77.8 80.2 80.3 79.9 82.0 Mi Hr Chevallier 78.4 81.3 79.6 Mi Hr Triumph 80.1 81.7 81.6 82.0 81.2 Mi Hr Sebastian 83.4 80.4 82.5 78.9 Mi Hr Optic 80.8 82.0 82.0 Mi Hr Power 81.0 85.0 Mi Hr Harrington 83.9 79.3 83.7 82.1 82.2 81.5 Hr Hr AC Metcalfe 82.5 80.0 83.0 82.5 Hr Hr CDC Kendall 82.7 79.7 83.5 82.4 78.7 Hr Hr CDC Copeland 82.6 80.1 83.4 83.2 82.3 81.8 Hr Hr CDC PolarStar 82.9 81.5 Hr Hr CDC Aurora Nijo 80.3 83.4 81.6 81.9 Hr Hr Flagship 82.1 80.6 Hr Hr 1: Production year. 2, 3: CAPS markers for QTLs of malt extract on 5H and 2H, Mi; Mikamo Golden allele, Hr; Harrington allele. </p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us