<p> June Review Enriched Term 3</p><p>Topic 1- Heat, potential, kinetic and mechanical energy, forces, motion and work</p><p>1. Define the following: Heat energy Kinetic energy Potential energy</p><p>2. Give the formulas and units for the following: Heat energy Kinetic energy Potential energy Mechanical energy</p><p>3. How do you convert the following: m to km g to kg km/h to m/s kWh to J</p><p>4. What are the formulas for initial and final temperature?</p><p>5. What was the mass of water if it absorbed 3 007 J of heat with an original temperature of 40.0°C and a final temperature of 54°C?</p><p>6. What is vinegar’s specific heat if 30.0 g was heated for 18 minutes and had a temperature change of 26°C to produce 50 500 J of heat?</p><p>7. There was 20.0 g of water with an initial temperature of 1.0°C. The water had absorbed 2 100 J of energy. What was the water’s final temperature? 8. Syrup absorbed 5 500 J of heat with a specific heat of 1.3 g/J°C. What was the syrup’s initial temperature if 210 g of had a final temperature of 55°C. </p><p>9. A bow and arrow weighing 3.0 kg is raised 9.0 m. What is its potential energy?</p><p>10. A rock weighs 9.0 kg and has a potential energy of 1 200 J. What height is it found at?</p><p>11. A ball is raised 5.0 m off the ground and weighs 750 g. What is its potential energy?</p><p>12. A truck weighing 17 000 kg has 9 005 J of kinetic energy. What is the speed it is </p><p> travelling at?</p><p>13. A camp has a waterslide that is 5.0 meters high. Debra, a 55 kg camper, is sliding down the waterslide from rest. See Figure 6 below. </p><p>How fast will Debra be travelling when she reaches the water? Neglect air and friction. 14. Define the following terms:</p><p>Motion Forces Work Effective force</p><p>15. What is earth’s and the moon’s gravitational force equal to?</p><p>16. What is the formula for work with its units?</p><p>17. How much work does the gravitational force acting on a skier represent if the skier has a mass of 55 kg and travels 4.0 km down a hill with a 40.0° angle?</p><p>18. What is the work done if a skier with a mass of 70.0 kg skis down a hill at a 40.0° angle for 30.0 m?</p><p>19. Explain if each person will be able to lift their luggage weighing 25 kg off the floor if they both are lifting the luggage at a 25°, but person 1 is using 300 N of force and person 2 is using 500.0 N of force. 20. A person is pulling a box along the floor with a force of 60.0 N at an angle of 60.0° to the horizontal. What is the effective force?</p><p>21. How much work was done when a man pulled his luggage at the airport for 305 m with a force of 85 N at a 35° angle?</p><p>22. If each of the carts illustrated below travels a distance of 4 m, in which situation will the energy gained by the cart be greater? Show your calculations. a) b)</p><p>23. A grocer has received guidelines from the Workplace Health and Safety Board on the prevention of injuries at work. These guidelines state that his employees should not be required to apply a force of more than 85 N when pulling the cart.</p><p>The grocer has collected some data on the carts his employees use and how they use them in order to help him determine if the guidelines are respected.</p><p>Cart Handle</p><p>40°</p><p>Horizontal</p><p>Distance = 4.5 m</p><p> The handle is at an angle of 40.0° to the horizontal  The cart is pulled for 4.5 m  The effective force is 40.0 N</p><p>Assume that the floor is frictionless. a- Determine whether or not the store’s use of the cart respects the guidelines of a maximum applied force of 85 N. b- Calculate how much work is done when the cart is used as described above. </p><p>Topic 2- Ecosystems</p><p>1. Explain eutrophication and the phosphorus cycle.</p><p>2. Define the following terms Ecological footprints Toxicity threshold Ecotoxicology Contaminants </p><p>3. What can you do to decrease your ecological footprint? </p><p>4. What 3 things does toxicity depend on? 5. Explain bioaccumulation and bioconcentration.</p><p>6. In a food chain, which organism will have the most contaminant in it and why?</p><p>Topic 3- Genetics</p><p>1. Give a brief description of the following terms: Chromosomes </p><p>Genes </p><p>DNA </p><p>Nitrogen bases</p><p>Ribosome</p><p>Transcription</p><p>Translation </p><p> mRNA</p><p> tRNA</p><p>Amino acids Protein </p><p>2. Explain the process of how proteins are made.</p><p>3. Below is a section of a DNA strand that will code for a protein. TACATGAGACCTTTTGTTGTGCGGGGCATT</p><p>A- What is the mRNA strand corresponding to the above DNA strand? </p><p>B-What are the tRNA anticodons associated with this mRNA strand? </p><p>C-Give the amino acid sequence produced.</p><p>Use the following table to complete question 4</p><p>Trait</p><p>Stem Seed Seed Seed coat Pod shape Pod length shape colour colour colour</p><p>Dominant tall round yellow coloured inflated green</p><p>Recessive short wrinkled green white constricted yellow</p><p>4. Give all the possible alleles which could represent the following: Tall plant Wrinkled Yellow White coat Inflated Green pod Yellow pod seed pod</p><p>5. In guinea pigs, a black coat is dominant over a brown coat. What are the genotypes and phenotype percentages?</p><p>6. Huntington’s is a fatal dominant disease. If a heterozygous man who has Huntington’s marries a normal female, what are the chances that their child will have Huntington’s? </p><p>7. Colour blindness is a sex-linked trait. What are the outcomes for the children is a non colour blind man mates with a carrier female?</p><p>8. In summer squash, white fruit color is dominant over yellow fruit color and disk-shaped fruit is dominant over sphere-shaped fruit. If a squash plant true- breeding for white, disk- shaped fruit is crossed with a plant heterozygous plant for both traits, what will the phenotypes and genotypes be? Topic 3- Mole and stoichiometry</p><p>1. What is Avogadro’s number equal to?</p><p>2. What is mole of zinc equal to?</p><p>3. What is the molar mass of nitrogen?</p><p>4. What is the mass of:</p><p>1.00 mol CO2 2.0 mol of C6H12O6 0.03 mol of NaCl 0.55 moles of PCl3</p><p>5. What mass of solute is required to prepare 350 mL of NaOH at a concentration of 0.75 mol/L?</p><p>6. What is the molar concentration of the water in an aquarium that contains 100.0 L of salt water prepared with 2.8 kg of sodium chloride (NaCl)?</p><p>7. Explain the lab procedure involved in preparing 250 mL of a 3.0 mol/L solution of CaCO3.</p><p>8. What is the molarity of a 10.0 L solution of HCl that contains 0.36 g of solute? 9. Iron rusts according to the following equation:</p><p>4 Fe + 3 O2 → 2 Fe2O3 By how much will the mass of 10.0 g of iron increase the mass of Fe2O3?</p><p>10. Consider the following unbalanced equation: </p><p>C2H4 + O2 → CO2 + H2O</p><p> a- How many moles of carbon dioxide will react with 5.0 moles of oxygen?</p><p> b- How many moles of oxygen are needed to form 20.0 g of water?</p><p> c- What mass of carbon dioxide will be produced if 100.0 mL of water is formed?</p><p>11. Aspirin (C9H8O4) is produce from salicylic acid (C7H6O3) according to the equation below:</p><p>2 C7H6O3 + C4H6O3 → 2 C9H8O4 + H2O What mass of water forms at the same time as 540 g of aspirin?</p><p>12. A student prepared 1 250 mL of solution by using 17.0 g of aluminum sulfate, Al2(SO4)3 . What is the molar concentration of the solution?</p><p>13. How many grams of solute are there in 350.0 mL of a solution of NH4OH with a concentration of 0.65 mol/L 14. You must prepare 500.0 mL of an aqueous solution of sodium nitrate (NaNO3) that will have a concentration of 0.40 mol/L. What mass of NaNO3 is required?</p><p>15. Iron oxide, Fe2O3, reacts with carbon, C, to produce iron, Fe, according to the following balanced equation: Fe2O3 + 3 C → 2 Fe + 3 CO What mass of carbon is required for every 6.00 moles of Fe2O3 used?</p><p>16. What is the difference between an exothermic and an endothermic reaction?</p>