<p> Clinical Perspective</p><p>Atrial fibrillation (AF) is the most common clinical arrhythmia associated with cardiovascular morbidity and increased mortality. Extensive evidence indicates that structural remodeling, particularly interstitial fibrosis, and electrical remodeling are the most important contributors to the foundation of AF substrate. We and Donahue et al [1] previously demonstrated a gene-painting method capable of 100% transmural gene transfer to all parts of the atria accessible from an open-chest pericardium approach. Using this atrial painting method, for the first time, we demonstrated that angiotensin converting enzyme 2 (ACE2) overexpression by homogeneous transmural atrial gene transfer could improve atria electrical and structural remodeling, and subsequently reduced the inducibility and duration of AF in a clinically relevant large animal model, Thus, the present study may provide a promising therapeutic target to the treatment of patients with AF via ACE2 overexpression, and in particular to prevent postoperative AF. Additionally, after successful establishment of a minimally invasive technique and following modifications of this method, ACE2 gene therapy could become a viable option to treat general AF.</p><p>1 / 8 < Supplement ></p><p>Method</p><p>Adenoviruses and Solutions A recombinant adenovirus carrying the Canis lupus familiaris ACE2 (Ad-ACE2) or a control transgene (adenovirus–enhanced green fluorescent protein [Ad-EGFP]) was prepared using the BLOCK-IT adenoviral expression system (Invitrogen, USA) as previously described [1, 3]. Adenovirus vectors were amplified and produced in 293 cells (Yrbio, Changsha, China) and purified by anion chromatography. Concentration of viral particles was determined by the TCID50 (50% tissue culture infective dose) method. Purified and concentrated adenoviral vectors (serotype 5), produced in 293 cells containing 2×1010 plaque-forming units (pfu) per milliliter were used. Quality control of virus stocks included virus concentration determination by DNA absorbance, infective particle titer by plaque assay, and transgene expression confirmation by western blot analysis after transduction of HeLa cells, and absence of replication-competent virus by polymerase chain reaction analysis. Before the procedure was begun, the infection solution was prepared in phosphate- buffered saline (PBS) chilled to 4°C, and poloxamer F127 (BASF Corp, Mt Olive, NJ) was slowly added. Immediate before use, adenovirus and trypsin stock solutions were added to the poloxamer/PBS for a final virus concentration of 1×109 pfu/ml, poloxamer concentration of 20% (wt/vol), and final trypsin concentration of 0.5% (wt/vol). After it was completely mixed, the solution was warmed at 37°C to achieve a firm gel consistency.</p><p>More detailed information about ACE2 gene and adenoviral expression system:</p><p>Figure 1. The plasmid profile of pYr-ads-1-ACE2 Note: A recombinant adenovirus carrying the Canis lupus familiaris ACE2 (Ad-ACE2) or a control transgene (adenovirus–enhanced green fluorescent protein [Ad-EGFP]) was prepared using the BLOCK-IT adenoviral expression system (Invitrogen, USA) as previously described [1, 3]. Adenovirus vectors were amplified and produced in 293 cells (Yrbio, Changsha, China) and purified by anion chromatography.</p><p>2 / 8 Canis lupus familiaris angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 (ACE2), mRNA NCBI Reference Sequence: NM_001165260.1 http://www.ncbi.nlm.nih.gov/nuccore/NM_001165260.1</p><p>Figure 2. The sequencing results of pAd-ACE2 (coding sequence/CDS)</p><p>3 / 8 Results</p><p>Gene transfer efficiency during 5 weeks experiment period We have previously shown that epicardial gene painting causes homogeneous and complete transmural atrial gene transfer [2]. The mixture solution contained rAd-EGFP( 1×109 pfu /mL), trypsin( 0. 5% ) and poloxamer F407 ( 35% ) and was spread on the right atrial epicardial via median sternotomy. The fluorescence intensity of atrial tissue at different transfer time points was observed by fluorescent microscopy (Figure 3).</p><p>Figure 3. ACE2 Expression Staining After Gene Transfer in 4 Groups of Dogs</p><p>Real time PCR was used to analysis EGFP mRNA expression level positions from different part of the heart. The EGFP mRNA expression showed an initial increase followed by a decrease with a peak at week 3, where almost every myocardial layers of right atrium anterior wall (RAAW) showed the transgene expression with the highest level at the right atrium anterior. </p><p>The results showed that the EGFP mRNA expression showed an initial increase followed by a decrease with a peak at week 3, where almost every myocardial layers of right atrium anterior wall ( RAAW) showed the transgene expression with the highest level at the right atrium anterior RAA). Similar level of EGFP expression was observed in RAAW and right atrium anterior wall (RAPW); and the expression in interatrial septum (IAS) was significantly lower than right atrium (RA), but higher than that in left atrium anterior (LAAW) and posterior wall (LAPW). The lowest levels of EGFP mRNA expression was found in ventricular and other organs such as lung, liver, spleen, skeletal muscle, stomach, and small intestine, etc. (*P<0. 01 compared with RA).</p><p>Figure 4. The EGFP mRNA expression level of different atrial positions in the 3rd week</p><p>4 / 8 group. Note: there was higher expression level in RAA compared with other positions（*p = 0.039）. The EGFP mRNA expression level of RAAW was the same as RAPW. Compared with RAPW, the EGFP mRNA expression level of IAS was lower（**p=0.015）.( RAPW, right atrial posterior wall; RAA, right atrial appendage; IAS, interatrial septum; LAAW, left atrial anterior wall; LAPW, left atrial posterior wall.( Cited from: Chinese Journal of Biochemistry and Molecular Biology., 2011, 27(12): 1167-1173.)</p><p>5 / 8 Table 1. Primer Sequences Gene Forward Primer (5’-3’) Reversed Priner (5’-3’) ACE2 AGAGGAGTGGGAAAACGGCTAT AGGAAGGGTAGGTGTCCATCAA AT1R AGATCGCTTCAGCCAGTGTTAG AAGGCGGGACTTCATTGGAT AT2R CCACCTGAGAAATATGCCCAAT CGAGTTATTCTGTTCTTCCCATAGC TGF-β1 ACCAACTACTGCTTCAGCTCCAC GTGTCCAGGCTCCAAATGTAGG Col 1α2 GACCCCAAAGTCTACCCAAAGAG AGGTGCTGATGTACCAGTTAGGG Col 4α5 ACCTACTCTCTGCCATCAAGAGC GAGTCGATCACCCTTCTCCAGT GJA1 GTCGTGTCCTTGGTGTCTCTTG ACAGTCTTTGGAGGGGCTCAGT GJA5 CAGGCAGATTTCCAGTGTGAT AGTAGCGGATGTGAGAGATGG KCND2 TGAGTTTGTGGATGAGCAGGTC CGGAAGGTTTTCTTGTGTCGTC KCND3 AGAATCAGAGAGCCGATAAACG CCACAAGATAGGACAACCCAGT KChIP2 CTGGTTTGTCGGTGATTCTTC TCCTTGTTCCTGTCCATCTTCT CANAC1 GGCACCCTCCTACCTTTTGTTA GCTCTTCCTCGCTCTTCTGACAT GAPDH TCCATGACAACTTTGGCATCGTGG GTTGCT-GTTGAAGTCACAGGAGAC</p><p>Note: ACE2, Angiotensin converting enzyme 2; AT1R, Angiotensin II Type 1 Receptor; AT2R, Angiotensin II Type 2 Receptor; TGF-β1, transforming growth factor -β1; Col 1α2, collagen, type I, alpha 2; collagen, type IV, alpha 5; GJA1, gap junction protein, alpha 1(CX43); GJA5 gap junction protein, alpha 5 (CX40); KCND2, potassium voltage-gated channel, Shal-related subfamily, member 2; KCND3, potassium voltage-gated channel, Shal-related subfamily, member 3; KCNIP2 Kv channel interacting protein 2; CACNA1C, calcium channel, voltage- dependent, L type, alpha 1C subunit; GAPDH, glyceraldehyde phosphate dehydrogenase</p><p>6 / 8 Table 2. The important information of the major antibodies. Name Manufacturers Catalog # dilution ratio anti-ACE2 Abcam, United Kingdom ab87436 1:500 Anti-Mas SANTA CRUZ, USA sc-135063 1:100 anti-Ang II Phoenix Pharmaceuticals H-002-12 1:100 anti-Ang-(1-7) Phoenix Pharmaceuticals H-002-24 1:100 anti-L-type Ca++ CP α1C SANTA CRUZ, USA sc-16229-R 1:100 anti-KV4.2/4.3 SANTA CRUZ, USA sc-28634 1:100 anti-Phospho-p44/42 MAPK (p- Cell Signaling, USA #4370 1:1000 ERK1/2) anti-p44/42 MAPK (ERK1/2) Cell Signaling, USA #4695 1:1000 anti-p38MAPK Abcam, United Kingdom ab7952 1:200 anti-Collagen-III Abcam, United Kingdom ab23445 1:200 anti-Collagen-I Abcam, United Kingdom ab96723 1:200 anti-CX43 SANTA CRUZ, USA sc-13558 1:200 anti-CX40 SANTA CRUZ, USA sc-20464 1:100 anti-TGF-β1 SANTA CRUZ, USA sc-146 1:100 anti- Fibronectin SANTA CRUZ, USA sc-73611 1:100 anti-MKP-1 SANTA CRUZ, USA sc-1102 1:100 anti-tubulin Beyotime, China AT819 1:1000</p><p>7 / 8 References: 1. Amit G, Kikuchi K, Greener ID, Yang L, Novack V, Donahue JK (2010) Selective molecular potassium channel blockade prevents atrial fibrillation. Circulation 121:2263-2270 doi:10.1161/CIRCULATIONAHA.109.911156 2. Cui K, Fan J, Kao G, Ling Z, Yin Y, Su L (2011) A Method for Highly Effective Gene Transfer into Atrial Myocardium by “Painting” on Atrial Epicardial in Canine. Chinese Journal of Biochemistry and Molecular Biology. 27:1167-1173 3. Dai Y, Qiao L, Chan KW, Yang M, Ye J, Zhang R, Ma J, Zou B, Lam CS, Wang J, Pang R, Tan VP, Lan HY, Wong BC (2009) Adenovirus-mediated down-regulation of X-linked inhibitor of apoptosis protein inhibits colon cancer. Mol Cancer Ther 8:2762-2770 doi:10.1158/1535-7163.MCT-09-0509</p><p>8 / 8</p>