Supplementary Data s12

Supplementary Data s12

1 Supplementary Data 2 3 4Role of Nrf2 antioxidant defense in mitigating cadmium-induced 5oxidative stress in the olfactory system of zebrafish 6

7Lu Wang and Evan P. Gallagher* 8 9Department of Environmental and Occupational Health Sciences, University of 10Washington, Seattle, WA, USA 11 12 13*To whom correspondence should be addressed: 14 15Department of Environmental and Occupational Health Sciences, 16School of Public Health, 174225 Roosevelt Way NE, Suite 100 18Seattle, WA 98105 – 6099 19United States 20Telephone: 1-206-616-4739 21Fax: 1-206-685-4696 22E-mail:[email protected] 23 24 25 26 27Supplementary Materials and Methods: 28 29Supplemental Table 1. The nominal (and measured) cadmium concentrations 30from adult zebrafish waterborne exposures and measured cadmium stock for 31embryonic exposures. 32 33Sample Nominal Measured a 34Control 0 ppb <1 ppb (BDL) Cd-L 11 ppb 11 ppb 35Cd-H 110 ppb 106 ppb 36Cd stock for embryonic 112 ppm 112 ppm 37exposures 38 39 40a BDL-below detection limit 41Supplemental Table 2. Sequences of PCR primers used in this study.

Gene name Genbank Forward Primer (5’ to 3’) Reference accession no. gst pi NM_131734 Forward: CTTCACTCAGCGCTACAAC (Kobayashi et al., Reverse: TGGCCAGAACATTTTCAAAGC 2002) gclc NM_199277 Forward: AACCGACACCCAAGATTCAGCACT (Timme-Laragy Reverse: CCATCATCCTCTGGAAACACCTCC et al., 2009) prdx1 NM_001013471 Forward: TTTCATTCATTCACTCTCGGATT (Bui et al., 2012) Reverse: AAACTGTCCATCAGGCATCAC hmox1 NM_001127516 Forward: ACGCTTACACCCGCTACCTC (Bui et al., 2012) Reverse: ATCCCCTTGTTTCCAGTCAG omp NM_173281 Forward: ACGACGAGAACATCCAGTGTTA Reverse: ACAGACTGACCAGAAGAGAGCC trpc2 NM_001030166 Forward: GACGAGCTCCTCCGTTACAG Reverse: CGTTTCCACTCTCAGCATCA s100z BC095285 Forward: ACGCCTTCATCTCTCAACTCTC Reverse: TTAAAGTCCACCTCGTTGTCCT -actin2 NM_181601 Forward: AAGCAGGAGTACGATGAGTC (Tilton et al., Reverse: TGGAGTCCTCAGATGCATTG 2008) 43Supplementary Data: 44Supplemental Figure 1. To test Nrf2 knockdown efficiency, 48 hpf and 96 hpf old (20- 4525 larvae per pool) non-injected, conMO and nrf2MO-injected embryos were exposed to 46either tert-butylhydroquinone (tBHQ, 3 M) or the vehicle control (DMSO, 0.01% 47vol/vol) for 3 h at 28 oC. Following exposures, the larvae were analyzed for expression of 48gst pi and gclc, both of which are downstream targets of Nrf2. Each treatment group was 49normalized to their respective DMSO controls (ANOVA, * p <0.05; **p<0.01 and *** 50p<0.001, mean ± SEM of n=3 to 5 individuals).

gst pi gclc 4 DMSO 2.5 o

t tBHQ

e

v 2.0

l * i 3 t o *** r

a *** t l *** e n

r 1.5 o

c e

2 g O n 1.0 S a h M c

D 1

d 0.5 l o F 0 0.0 NI conMO nrf2MO NI conMO nrf2MO NI conMO nrf2MO NI conMO nrf2MO

48 hpf 96 hpf 48 hpf 96 hpf 51 52Supplemental Figure 2. Scanning electron microscopic view of a 96 hpf zebrafish larvae 53neuromast cell (scale bar =2 m). A loss of hair cells in neuromasts was observed in 25 M 54Cd group, with SFN pretreatment providing partial protection against hair cell loss. 55

DMSO SFN

l

ro

nt

o

C

d

C

M M

 25 25

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    5 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us