Supplementary Table 1: Gene-Specific PCR Primers Used for Semi-Quantitative and Quantitative

Supplementary Table 1: Gene-Specific PCR Primers Used for Semi-Quantitative and Quantitative

<p>Supplementary table 1: Gene-specific PCR primers used for semi-quantitative and quantitative RT-PCR</p><p>Gene Forward Primer 5’ → 3’ Reverse Primer 5’ → 3’ WRKY family protein CCATCATTTGGACCTCAGAT TTCTGCATTCTTTGCTTCCA C2 domain-containing protein AAGGTGAAGCAAGACGTGGT TGCGAGCTATGCAAGACTGT DEAD/DEAH box RNA helicase ACTGCACTGGCTTTCTCGTT GTAATGCCTCGTCCGAAACT Oryzain Alpha TACCCCATCTGCAATGTTCA GGCTCTGGACGGTCTGATAC Rhomboid protein-related CACCTGCCTATGTGCTTTGT CATCTGGATGGGGATGTCA Chlorophyll a/b binding protein CAGTTGCAGCAGTGCATGTAT CGATCCAAAGAAGCAAAGATG -glucosidase GCCTACTGGTTCAGGGACAT TTCATAGCCAGCTCTGATGC NADH-ubiquinone oxidoreductase CAGAGCAAGCCTGAGCACTA CTCGCACAACAGATTGGAGA Staygreen CTACCAAACCGAGCCAAAAT ACCAAAACGACTCTTGACAGC OsFER TAAGCACGCAGTAGCAATGG GCGCGACATACACATGATTC</p><p>Article title: Identification of Fe-excess-induced genes in rice shoots reveals a WRKY transcription factor responsive to Fe, drought and senescence</p><p>Journal name: Molecular Biology Reports</p><p>Author names: Felipe Klein Ricachenevsky1, Raul Antonio Sperotto1, Paloma Koprovski Menguer2, </p><p>Janette Palma Fett1,2</p><p>Affiliation: 1Centro de Biotecnologia, 2Departamento de Botânica, Universidade Federal do Rio Grande do Sul, P.O. Box 15005, 91501-970, Porto Alegre, RS, Brazil.</p><p>E-mail address of the corresponding author: [email protected]</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    1 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us