
<p>Electronic Supplementary materials </p><p>Table 1 Microsatellite amplification primers and optimization conditions. Repeat motif, clone size, primer sequences and optimization conditions are listed for each locus. *The Taq buffer already contains 2mM MgCl2 so these represent amounts added to increase the final MgCl2 concentration</p><p>Table 2 Pairwise Linkage Disequilibrium Comparison of p-values. All loci were tested for linkage disequilibrium against each other using Genepop 4.0. Underlined p-value indicates borderline significance level. </p><p>Table 3 GENELAND number of clusters for runs with correlated allelic frequencies and spatial data, skewness of the density distributions and significance.</p><p>Table 4 Evidence for significant overall population size reduction through significant M-ratio calculated for all localities in all three islands, localities on each volcano on Isabela, and localities within each of the main areas on Santa Cruz. Locus Repeat Clone Primer Sequence Touchdown Additional MgCl2 Motif size Temp. Range Concentration* (bp) (C) (mM)</p><p>R2 (CA)5 219 F-TAACGTTTATACACTGAAAATTACAGG 61-55 2.0 R-AATGGTTATATGTACAACCAAGGATTG</p><p>AH4_2 (TG)7 183 F-GCAGCCTACGCAGGAGTAAGAA 68-60 1.5 R-TAACATGGGAGCCATGACAAG</p><p>AH25_2 (TG)10 290 F-AAAAACCTTTGACATGGTGATG 70-63 2.0 R-CAGTCATTGGTGTAATCTCCACA</p><p>AE50 (GT)7 474 F-GTCGCTCATCTCAACCCAAT 70-63 0.0 R-GGACGCACAATCCCAATAGT</p><p>AE17 (CA)6 247 F-CGAAATAAATCACAAAACACTTTTC 61-66 2.0 R-GTTGGTTCGTCTGGTCTGGT</p><p>AE27 (TG)5 256 F-CTTCGAATGAGCGACCAGTT 58-56 2.0 R-TGGACCAACGCCCTTAATAC</p><p>CH25 (AG)9 217 F-CGAAATTCGCCACCCTATAA 65-58 1.5 R- GCATGGGTTGACGTGTCTTT</p><p>CG34 (AG)9 162 F-TTTGGATAATATTCCAGTAGCTTCG 65-55 1.5 R-CCGTTTAACCGTCTTTGGAG</p><p>CB11 (AG)13 248 F-GCGCGTCACGTAAAACTTATAG 61-55 0.0 R-CGGCGAAACACACATTAACA</p><p>CE16 (GA)10 233 F-TTTTAAAAGCATCAAGTGAGCA 65-55 0.5 R-ACAAATTCGACGGGTTTGAG</p><p>CG37 (TC)16 229 F-TAAAAAGTCCGCATGGGTTG 65-55 0.0 R-CGAAATTCGCCACCCTATAA</p><p>CB24 (AG)8 254 F-ATAACTGACTCTTTTCGCATTT 55-50 2.0 R-TTTTTCAAGGATAACTATCTCTCTT</p><p>CA06_2 (TCC)5 240 F-TGGCATTTCAGTAAAACAAC 65-55 0.5 R-CCCAAAAGAAATTGCTGGAA AH4_2 AH25_2 AE50 AE17 AE27 CH25 CG34 CB11 CE16 CG37 CB24 CA06 R2 1 0.9 1 1 0.998 1 1 0.273 0.988 0.83 1 1 AH4_2 - 0.479 0.863 0.784 0.926 0.605 0.871 0.988 0.999 0.647 0.728 0.365 AH25_ - 0.827 0.987 0.964 1 0.991 1 0.301 0.986 0.961 0.994 2 AE50 - 0.997 0.52 1 0.977 0.966 0.866 0.765 0.954 0.985 AE17 - 0.704 0.901 1 0.943 1 0.999 1 0.075 AE27 - 0.864 0.74 0.975 0.858 0.993 0.999 0.701 CH25 - 0.991 0.756 0.95 0.055 0.62 0.786 CG34 - 0.998 0.165 1 0.843 0.951 CB11 - 1 1 0.998 0.632 CE16 - 1 0.979 0.999 CG37 - 0.9999 0.994 CB24 - 0.888 CA06 - Island Model Number of Skewness genetic clusters All islands Correlated Spatial 7 -1.14** Correlated Non-Spatial 10 -0.12* Isabela North Correlated Spatial 7 -1.68** Correlated Non-Spatial 7 -0.18* Isabela Central Correlated Spatial 8 -1.99** Correlated Non-Spatial 8 -0.33* Santa Cruz Correlated Spatial 2 2.63** Correlated Non-Spatial 2 1.31* Island/ Area Area/Volcano Locality Code M M and Name (significance) (significance) per collecting per collecting locality area and /or volcano Isabela Central: Alcedo IS02/IS12 1.5981 0.4138 (*) Los Guayabillos IS07 1.5378 0.4101 (*) 0.4177 (*) Los Pega Pega Central: Darwin IS13 1.5270 0.4642 (NS) Camp at 300m IS03 1.5355 0.4112 (*) Camp at 700m (*) IS041 1.5107 0.4268 Camp Cumbre (*) (*) IS05/IS061 1.5373 0.4199 0.4326 Cumbre Isabela North: Wolf IS16/IS17 1.5373 N/A Near coast & Camp IS18 1.5472 0.4258 (*) LUNCH site IS19 1.5843 N/A 0.4262 (*) Highest point reached North: Ecuador IS20 1.5331 N/A Ecuador south coast IS21 1.5191 N/A 0.4011 (**) Ecuador top Santa South East SR16 1.6196 0.4699 (NS) Cruz Tortuga Bay SR03 1.5559 0.4788 (NS) CDRS SR21 1.6407 0.4518 (NS) El Chato SR15 1.6407 N/A Caamano SR19 1.6003 0.4925 (NS) Garrapatero SR20 1.5117 N/A Between Garrapatero and Bellavista SR34 1.8106 N/A 0.4791 (NS) West end agricultural region Santa Los Gemelos SR13/SR25/SR27 1.5817 0.4487 (*) Cruz Los Gemelos SR23 1.6012 0.4951 (NS) Mina de Granillo Negro SR33 1.6097 0.4479 (NS) 0.4787 (NS) Mina de Granillo Rojo Santa Conway Bay SR30 1.5052 0.4529 (NS) Cruz At the Beach SR31 1.5343 0.4772 (NS) Up the trail CB SR32 1.5344 0.4987 (NS) 0.4577 (NS) At 50m CB Pinta Southern slope PI02 1.6063 0.5549 (NS) N/A Highest point </p>
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages6 Page
-
File Size-