<p>Table S1 : Morphological character matrix of 18 characters for 19 Pionus taxa and for the outgroup taxon, Graydidascalus brachyurus.</p><p>Taxa Characters1 1 123456789012345678 ______G. brachyurus 000000000000000000 menstruus 000110000000001000 rubrigularis 000110000000001000 reichenowi 000110000000001000 maximiliani 001000000000001110 melanoblepharus 001000000000001110 siy 001000000000001110 lacerus 001000000000001110 corallinus 100000000000001111 mindoensis 100000000000001111 saturatus 100000000011101100 antelius 100000000011111100 sordidus 100000000011111100 ponsi 1000000000121?1100 fuscus 000000000000000000 cyanensis 010001010100101000 chalcopterus 010001010100101000 senilis 010001100000101000 seniloides 010001101000101000 tumultuosus 010000001000101000 ______</p><p>1 External morphological characters and character-states used in our phylogenetic analyses of Pionus. All characters, except 12, are binary with 0 being the absence of the character, and 1 being presence. 1. entirely red bill; 2. entirely yellow bill; 3. bill, lower mandible horn color, dark at base, and upper mandible extensively dark except at tip; 4. bill dark, with large red patch at base of upper mandible, and with small red patch at base of lower mandible; 5. entire head (throat, cheeks, crown, hindneck) blue; 6. throat white; 7. extensive white on forehead and crown; 8. upper wing coverts and tertials bronze-brown; 9. cheek feathers with long, narrow central whitish streaks (more pinkish in P. tumultuosus); 10. extensive deep blue cheeks, belly and back that is tinged bronze-green; 11. upper breast and belly feathers light green, scalloped appearance due to terminal (or subterminal) band being lighter than base; 12. throat and upper breast with iridescent turquoise blue/turquoise green: (1) some turquoise blue feathers, (2) extensive turquoise green; 13. base of neck feathers white; 14. back light green, scalloped due to very light green terminal band and dark green base; 15. blue on upper breast; 16. malar area and side of neck posterior to eye with fan-shaped patch of lanceolate-shaped feathers, edged distally with blue; 17. malar feathers (character 16) large; 18. upper parts (mantle, wing coverts) uniform dark, dullish green/blue-green. Table S2: Taxa for which ND2 and cyt b sequences were obtained. Identification, institution, voucher number and collection locality.</p><p>Identification Institution* Voucher Collection locality P. menstruus IBUSP 846 Itaituba, Pará, Brazil P. menstruus IBUSP 866 Jacareacanga, Pará, Brazil P. menstruus IBUSP 2087 Acre, Brazil P. menstruus IBUSP 2938 Alta Floresta, Mato Grosso, Brazil P. reichenowii IBUSP 2488 Captive P. reichenowii IBUSP 2788 Captive P. reichenowii IBUSP 4401 Bahia, Brazil P. reichenowii IBUSP 4402 Bahia, Brazil P. rubrigularis NMNH B277 Bocas del Toro, Panamá P. rubrigularis. NMNH B311 Bocas del Toro, Panamá P. rubrigularis NMNH B551 Bocas del Toro, Panamá P. rubrigularis NMNH B1402 Bocas del Toro, Panamá P. maximiliani IBUSP 4376 Bahia, Brazil P. melanoblepharus IBUSP 3678 São Paulo, Brazil P. siy IBUSP 3679 Mato Grosso do Sul, Brazil P. lacerus UWBM 54384 San Miguel de Tucumán, Argentina P. lacerus UWBM 70701 San Miguel de Tucumán, Argentina P. lacerus UWBM 70450 San Miguel de Tucumán, Argentina P. sordidus AMNH 475464# San Esteban, Venezuela P. corallinus KUMNH 1535 Peru P. mindoensis AMNH 124023# Pichincha, Ecuador P. antelius AMNH 188168# Rio Neveri, Venezuela P. antelius AMNH 188169# La Trinidad, Venezuela P. saturatus AMNH 73195# Valpariso, Colombia P. ponsi AMNH 1171# Zulia, Venezuela P. seniloides ANSP 554 Carchi, Ecuador P. seniloides ANSP 563 Carchi, Ecuador P. tumultuosus FMNH 397722 Cuzco, Peru P. fuscus KUMNH 1523 Guyana P. fuscus KUMNH 1522 Guyana P. chalcopterus AMNH 133040# Antioquia, Colombia P. cyanescens ANSP 2958 Manabi, Equador P. cyanescens ANSP 2779 Guayas, Equador P. senilis KUMNH 1521 Honduras P. senilis NMNH B00904 Captive * IBUSP: Instituto de Biociências da Universidade de São Paulo; NMNH: National Museum of Natural History; UWBM: University of Washington Burke Museum; KUMNH: Kansas University Museum of Natural History; AMNH: American Museum of Natural History; FMNH: Field Museum of Natural History; ANSP: Academy of Natural Sciences of Philadelphia. # Sequences obtained from skins. Table S3: Taxa for which RAG 1 and RAG 2 sequences were obtained. Identification, distribution, institution and voucher number are shown. All additional RAG 1 sequences were obtained from GenBank. </p><p>Identification Distribution Institution* Voucher Region Nestor notabilis Australasian AMNH 13087 RAG 1 and 2 Calyptorhynchus funereus Australasian AMNH 2423 RAG 2 Psittacus erithacus Afrotropical AMNH 10251 RAG 1 and 2 Alisterus scapularis Australasian AMNH 2392 RAG 2 Micropsitta bruijnii Australasian AMNH 13856 RAG 1 and 2 Micropsitta keiensis Australasian AM 329CA RAG 2 Psittacella brehmi Australasian AMNH 13855 RAG 2 Agapornis personata Afrotropical AMNH 9213 RAG 1 and 2 Platycercus elegans Australasian AMNH 2393 RAG 2 Psephotus haematonotus Australasian AMNH 2421 RAG 2 Melopsittacus undulatus Australasian AMNH 9145 RAG 2 Trichoglossus haematodus Australasian AMNH 2397 RAG 2 Pionites melanocephala Neotropical NMNH B9553 RAG 2 Ara chloroptera Neotropical AMNH 11002 RAG 2 Pyrrhura melanura Neotropical AMNH 12781 RAG 2 Touit purpurata Neotropical NMNH B10897 RAG 2 Nannopsitta panychlora Neotropical AMNH 9735 RAG 2 Brotogeris chrysopterus Neotropical FMNH 389684 RAG 2 Miyopsitta monachus Neotropical AMNH 2263 RAG 2 Gypopsitta barrabandi Neotropical FMNH 389691 RAG 2 Amazona leucocephala Neotropical AMNH 6817 RAG 2 Graydidascalus brachyurus Neotropical FMNH 391243 RAG 2 Pionus rubrigularis Neotropical NMNH B311 RAG 2 Pionus fuscus Neotropical KUMNH 1523 RAG 2 Pionus senilis Neotropical KUMNH 1536 RAG 2 Pionus lacerus Neotropical UWBM 70701 RAG 2 Pionus corallinus Neotropical KUMNH 1535 RAG 2 *AMNH: American Museum of Natural History, AM: Australian Museum, NMNH: National Museum of Natural History, FMNH: Field Museum of Natural History, KUMNH: Kansas University Museum of Natural History, UWBM: University of Washington Burke Museum. Table S4: Primers used.</p><p>Gene Primer Sequence 5’ – 3’ Reference Cyt b N5L14750 GGACCAGAAGGACTTGCCGACCTA Ribas et al. 2005 CBH15422 GGTGGGGTTGTCTACGGAGAA Ribas et al. 2005 CBL 15298 TGAGGCCAAATATCATTCTGAGGGGC Cheng et al. 1994 CBH 15764 CCTCCTAGTTTGTTGGGGATTGA Miyaki et al. 1998 CBL 15507 AACCTACTAGGAGACCCAGA J. Feinstein (pers. comm.) HB20 TTGGTTCACAAGACCAATGTT J. Feinstein (pers. comm.) Cyt b CBL1 CAAAACCTACCTAGGATCATTCGCAC This study (skins) CBH1 GGTRTCTGCGGTGTAGTGGGC This study CBL2 ATCTCCGCCTGATGAAACTTCGG This study CBH2 TAGTAGAAGCCTCGGGCGATGTG This study CBL3 AACCTYCAYGCAAACGGAGCCTC This study CBH3 TGGGGTTGTCTACGGAGAATCC This study CBL4 CATCGGACAAACCYTAGTAGAATG This study CBH4 CCTAGTARGTTGGGRGAGAAT This study CBL5 TCCCTAAAAGACCTRCTAGGRT This study CBH5 GTTGTTTGGATTTGTGGAGGAGG This study CBL6 CCTRGCCGCCTCCGTACTAAT This study CBH6 TTGTAAACTACTAGAGTTTAGTTTAGG This study ND 2 LMet GGCCCATACCCCGAAAATGA J. Groth (pers. comm.) H5764 GAGAAGCTAGGATTTTTCGTG P. Brito (pers. comm.) L5602 GATTCCCAGAAGTTCTTCAAGG P. Brito (pers. comm.) H6313 CTCTTATTTAAGGCTTTGAAGGC Sorenson et al. 1999 ND2 ND2H1 GGGTGATGTCTCATTGTCCTGTGT This study (skins) ND2L2 CGAGCCGTTGAAGCAGCAACCAA This study ND2H2 GGGATGTGATGAGTAGGAGTG This study ND2L3 GAAGTACTCCAAGGGTCATCCC This study ND2H3 GGTTAGTAGGGTTAGTTTKGGG This study ND2L4 GCCTTCTCATCYATCTCCCACC This study ND2H4 GATGAGTCATTTGGGYAGGAAGCC This study ND2L5 CTACTATCAYTAGCAGGCCTYCC This study ND2H5 CCTAAGTTTCTTAAGTGGTGGTG This study RAG2 R2-1 TCTTTTTTGGGCAGAAGGGATG Barker et al. 2004 R2-41 TCTACATTTTGGGAGGCCATTC This study R2-22 ACGCTCATGCTTTTTCCC Barker et al. 2004 R2-42 CAGGTCACAGCTGGGCTG This study R2-16 GACCCAGGTGTTAATGTC Barker et al. 2004 RAG1 R13 TCTGAATGGAAATTCAAGCTGTT Groth & Barrowclough 1999 R18 GATGCTGCCTCGGTCGGCCACCTTT Groth & Barrowclough 1999 R11 GGACCAGTAGATGATGAAACTCT Groth & Barrowclough 1999 R14 TTCCTGTGGATAATACTCCAGCA Groth & Barrowclough 1999 R17 CCCTCCTGCTGGTATCCTTGCTT Groth & Barrowclough 1999 R22 GAATGTTCTCAGGATGCCTCCCAT Groth & Barrowclough 1999 R20 CCATCTATAATTCCCACTTCTGT Groth & Barrowclough 1999 R21 GGATCTTTGAGGAAGTAAAGCCCAA Groth & Barrowclough 1999 R1 GACAAACATCTCAGGAAGAAGAT Groth & Barrowclough 1999 R24 GCCTCTACTGTCTCTTTGGACAT Groth & Barrowclough 1999 Table S5: Dates obtained from analyses of RAG2 and RAG1 datasets. Numbers refers to nodes common to both datasets and are indicated on figures S5 and S6.</p><p>Region RAG2 RAG2 RAG1 RAG1 method Bayesian PL Bayesian PL # of taxa 29 29 35 35 base pairs 1155 1155 2703 2703 Dates: Node 1 83.4 (82.1-85.0) 85 83.4 (82.1-84.9) 85 Node 2 64.9 (50.4-78.9) 61.9 (50.6-81.0) 69.1 (57.8-80.1) 65.9 (57.0-79.1) Node 3 57.8 (42.9-72.6) 55.6 (44.8-73.0) 58.4 (45.9-71.1) 53.9 (46.5-66.4) Node 4 24.1 (11.3-41.1) 20.9 (10.1-39.7) 15.9 (7.8-28.0) 8.2 (4.3-15.4) Node 5 33.3 (19.3-50.2) 31.6 (11.4-49.4) 37.7 (26.2-50.8) 34.6 (5.2-46.5) Node 6 19.5 (8.2-34.8) 16.3 (6.0-35.5) 21.1 (11.9-33.1) 19.1 (13.1-31.1) Node 7 21.0 (9.6-36.8) 16.9 (8.9-34.5) 21.7 (12.4-33.3) 17.7 (10.0-27.6) Node 8 13.3 (5.2-26.0) 9.2 (3.9-18.5) 15.2 (7.6-25.7) 10.7 (5.2-18.6) Node 9 6.9 (1.7-16.0) 4.3 (1.2-12.4) - - References</p><p>Barker, F. K., Cibois, A., Schikler, P., Feinstein, J. & Cracraft, J. 2004 Phylogeny and </p><p> diversification of the largest avian radiation. Proc. Natl. Acad. Sci. USA 101, 11040-</p><p>11045.</p><p>Cheng, S., Higuchi, R. & Stoneking, M. 1994 Complete mitochondrial genome </p><p> amplification. Nature Genet. 7, 350-351.</p><p>Groth, J. G. & Barrowclough, G.F. 1999 Basal divergences in birds and the phylogenetic </p><p> utility of the nuclear RAG-1 gene. Mol. Phylogenet. Evol. 12, 115-123. </p><p>Miyaki, C. Y., Matioli, S., Burke, T & Wajntal, A. 1998 Parrot evolution and </p><p> paleogeographic events: mitochondrial DNA evidences. Mol. Biol. Evol. 15, 544-551.</p><p>Ribas, C. C., Gaban-Lima, R., Miyaki, C. Y. & Cracraft J. 2005 Historical biogeography </p><p> and diversification within the Neotropical parrot genus Pionopsitta (Aves: </p><p>Psittacidae). J. Biogeog. 32, 1409-1427.</p><p>Sorenson, M.D., Ast, J. C., Dimcheff, E.D., Yuri, T. & Mindell, D. P. 1999 Primers for a </p><p>PCR-based approach to mitochondrial genome sequencing in birds and other </p><p> vertebrates. Mol. Phylogenet. Evol. 12, 105-114.</p>
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages6 Page
-
File Size-