<p>Vangamudi et al. (Supplementary Information)</p><p>Supplementary Information</p><p>The SMARCA2/4 ATPase domain surpasses the bromodomain as a drug target in SWI/SNF mutant cancers: Insights from cDNA rescue and PFI-3 inhibitor studies</p><p>Bhavatarini Vangamudi1, Thomas A. Paul3^, Parantu K. Shah1^, Maria Kost-Alimova1, Lisa Nottebaum3, Xi Shi1, Yanai Zhan1, Elisabetta Leo1, Harshad S. Mahadeshwar1, Alexei Protopopov1, Andrew Futreal2, Trang N. Tieu1, Mike Peoples1, Timothy P. Heffernan1, Joseph R. Marszalek1, Carlo Toniatti1, Alessia Petrocchi1, Dominique Verhelle3, Dafydd R. Owen4, Giulio Draetta1, Philip Jones1, Wylie S. Palmer1, Shikhar Sharma3*, Jannik N. Andersen1*.</p><p>1Institute for Applied Cancer Science, The University of Texas MD Anderson Cancer Center, TX. 2Department of Genomic Medicine, The University of Texas MD Anderson Cancer Center, TX. 3Pfizer Oncology Research Unit, La Jolla, CA. 4Pfizer Worldwide Medicinal Chemistry, Cambridge, MA.</p><p>Running Title: Targeting the SMARCA2/4 bromodomain in cancer using RNAi and PFI-3.</p><p>1 Vangamudi et al. (Supplementary Information)</p><p>One-sentence captions for all supplementary figures, tables, and methods sections</p><p>Supplementary figures: Figure S1. Genomic analysis of SWI/SNF alterations in human cancer. Figure S2. SMARCA4-deficient lung cancer cells depend on SMARCA2 expression for growth.</p><p>Figure S3. In-situ cell extraction assay for PFI-3 treatment. Figure S4. SMARCA2/4 bromodomain inhibitor does not alter growth of lung cancer cells. Figure S5. Analysis of SMARCA4 target gene expression and promoter occupancy following prolonged treatment with PFI-3. Figure S6. Pharmacological PFI-3 inhibitor studies in leukemia cells. Figure S7. Pharmacological EZH2 inhibitor studies. Figure S8. Genome-wide microarray analysis of SMARCA2 knockdown in A549 cells reconstituted with SMARCA4 cDNAs.</p><p>Supplementary tables: Table S1: Survey of genomic lesions in SWI/SNF across different cancer types. Table S2: Sequence information of shRNA’s and siRNA’s used in the study. Table S3. BROMOScan (DiscoveRx) profiling of PFI-3 (at 2uM) against 32 bromodomains. Table S4. Definition of gene sets (i.e. SMARCA2 knockdown signatures) from SMARCA4 rescue experiments in A549 cells. Table S5. Summary of GSEA normalized enrichment scores (NES) and false discovery rate (FDR) for rescue experiment using ATP-Dead, BRD-Mut and vector control and compared to WT. </p><p>Supplementary methods:</p><p>Lentiviral shRNA production and infection. Growth and colony formation assays. Immunoblotting. BROMOScan binding assays. In-situ cell extraction assay.</p><p>2 Vangamudi et al. (Supplementary Information)</p><p>PFI-3 inhibitor studies. Real-time quantitative PCR. Chromatin immunoprecipitation (ChIP). SMARCA4 cDNA complementation assay. SMARCA2 cDNA rescue experiment. Microarray analysis (mRNA expression profiling).</p><p>3 Vangamudi et al. (Supplementary Information)</p><p>Supplementary Figures</p><p>Figure S1. Genomic analysis of SWI/SNF alterations in human cancer. (A) Expanded view of genomic lesions (CN changes and mutation) in the canonical SWI/SNF subunits for LUAD patients (TCGA) visualized using cBio (www.cbioportal.org) OncoPrints and default colors: blue - high copy number loss (GISTIC 2.0 threshold value of -2); red - high copy number gain (GISTIC 2.0 threshold value of 2); green - mutations. Similar conclusions were obtained using either ABSOLUTE or GISTIC algorithms for CN variation analysis. (B) Outlier sum statistics analysis for TCGA Lung Squamous Carcinoma (LUSC). (C) Patterns of SMARCA2 and SMARCA4 CN lesions in LUAD and LUSC samples from TCGA. Copy numbers were defined using GISTIC and ABSOLUTE algorithms. Absolute Algorithm also provide ploidy information from the sample, allowing us to determine CN with respect to (WRT) overall sample ploidy (D) Quantification of Western blots (SMARCA2 and SMARCA4 protein expression) for the indicated lung cancer cell lines for the expanded panel of cell lines shown in Fig. 1G. (E) Correlation of SMARCA4 protein expression with public gene expression values in CCLE and (F) Sanger datasets. Cell lines to the left of the red dotted line, which have non-detectable SMARCA4 protein expression based on Western blotting, all have low SMARCA4 gene expression levels based on public genomic annotation from the Sanger and the Broad Institutes. (G) Mapping of SMARCA4 protein expression levels with SMARCA4 somatic mutations. Note that nearly all cell lines, which harbor mutations in SMARCA4 (10 out of 11 cases), display significantly reduced or abolished protein expression. The SMARCA4 mutant outliner NCI-H2286 harbors the mutation R1135Q which is annotated in the Broad Institute dataset (CCLE) but not the Sanger Institute dataset.</p><p>Figure S2. SMARCA4-deficient lung cancer cells depend on SMARCA2 expression for growth. (A) SMARCA2 protein knockdown in SMARCA4-deficient (H1299 and H517) and SMARCA4-proficient (H520 and Hela) cells using the indicated shRNAs. (B) Colony formation assay (six-well dish; 1,000 cells/well) transduced with either control (shLuc) or SMARCA2-targeting shRNAs and stained with crystal violet after 1.5-2 weeks. Results are representative of three separate experiments. </p><p>Figure S3. In-situ cell extraction assay for PFI-3 treatment. (A) Cell biochemical potency of PFI-3 using in-situ cell extraction protocols followed by fluorescence imaging. Hela cells stably expressing GFP-tagged SMARCA2 bromodomain (132 residues) were co-treated with SAHA and PFI-3 (or DMSO control) for 24 hours. The dose-dependent displacement of the SMARCA2 bromodomain from 4 Vangamudi et al. (Supplementary Information) chromatin is measured as loss of intensity of the GFP nuclear signal (green). (B) Quantification of fluorescence signal with bromodomain binding (IC50 = 5.53) detected as a decrease of mean nuclear GFP intensity in compound treated cells relative to intensity in DMSO treated control cells. Data is representative of two independent experiments performed in six replicate conditions. The IC 50 value is calculated using PRISM.</p><p>Figure S4. SMARCA2/4 bromodomain inhibitor does not alter growth of lung cancer cells. PFI-3 treatment of lung cancer cell lines (A) H1299, (B) H157, and (C) H460 does not inhibit growth in long- term colony formation assays. Media was replenished with compound every three days and colonies were stained with crystal violet. Data is representative of three replicate experiments.</p><p>Figure S5. Analysis of SMARCA4 target gene expression and promoter occupancy following prolonged treatment with PFI-3. Long-term PFI-3 treatment (6 days) does not repress Sox2 expression in either (A) Yamato cells or (B) Aska cells treated with the indicated concentrations of PFI- 3 (3, 10, 30 µM) compared to vehicle control (DMSO). Cells were replenished with fresh media and compound after 3 days. Sox2 mRNA levels were assessed at day 6 post-treatment using RT-qPCR. (Normalized to GAPDH; *P ≤ 0.05; error bars represent SEM, n=18; data representative of three biological replicate experiments). (C) The SWI/SNF complex is enriched at transcriptionally-active Sox2 locus in Yamato cells. Anti-SMARCA4 ChIP was performed followed by qPCR for regions at the human Sox2 promoter and a Sox2 transcription factor (TF1) binding sites within the exon. MyoD1 locus was used a negative control. (D) Pollymerase II (Pol II) ChIP was performed to validate the transcriptional-state of the respective loci in Yamato cells. GAPDH locus was used as a positive control for Pol II enrichment. Error bars represent SEM, n=3. </p><p>Figure S6. Pharmacological PFI-3 inhibitor studies in leukemia cells. PFI-3 inhibitor treatment does not inhibit growth of AML cells. (A) THP-1 and (B) MV4-11 cells were seeded in a 12-well dish in triplicates and treated with PFI-3 for 2 weeks. Cells were split and replenished with fresh media and compound every 3 or 4 days. Viable cells were counted at every time point and relative cell numbers were calculated. Error bars represent SEM, n=6. </p><p>Figure S7. Pharmacological EZH2 inhibitor studies. (A) EZH2 inhibitor (GSK126) treatment (7 days) inhibits viability of rhabdoid cancer cell lines, A204 (IC50 5.7µM) and G401 (IC50 3.7µM). Error bars</p><p>5 Vangamudi et al. (Supplementary Information) represent standard deviation (SD) from six replicates. (B) GSK126 does not inhibit growth of SMARCA4-deficient A549 cells or SMARCA4-proficient H460 cells. EZH2 mutant lymphoma cell line,</p><p>SU-DHL-4 (IC50 1.2µM) was used as a positive control for the 2D viability experiment. </p><p>Figure S8. Genome-wide microarray analysis of SMARCA2 knockdown in A549 cells reconstituted with SMARCA4 cDNAs. (A) Usupervised clustering of 1000 most variable genes (heat map) identifying 3 distinct expression patterns in the absence (Group 1; shLuc) and presence of SMARCA2 knockdown (Group 2 and 3; shSMARCA2). (B) Gene set enrichment analysis (GSEA) comparing Group3 (SMARCA4 rescue) versus Group2 (no rescue) showing differential expressed signatures from the Molecular Signatures Database at the Broad Institute (www.broadinstitute.org/gsea/msigdb). (C) Overview of data sets and sample annotation submitted to GEO (accession number GSE69088). (D) Total number of differentially expressed probes across various comparisons (1.3 fold change and 1% FDR was used in the representation) providing the basis for GSEA and SMARCA2 knockdown gene signatures. </p><p>6 Vangamudi et al. (Supplementary Information)</p><p>Supplementary Materials and Methods</p><p>Lentiviral shRNA production and infection. Lentivirus was produced by transfection of 293T cells with vectors encoding gene-specific shRNAs (3µg) together with packaging plasmids (2.7 µg of Δ8.9 and 0.3 µg of VSV-G) using Lipofectamine 2000 (Invitrogen). Medium was replaced 24 h following transfection and viral supernatants were collected at 48 and 72 h. Virus was pooled and filtered through 0.45 µM cellulose acetate filters (Corning) and stored at -800C. Cells were plated in a 6-well dish and infected with 2ml of lentiviral supernatant in the presence of polybrene (8 µg/ml) for 6 hours, and selected with puromycin starting 48 h post-infection. All NSCLC lines were selected with 1 µg/ml puromycin, and rhabdoid cancer cell lines were selected with 1.5 µg/ml puromycin. At 72-96 h post-selection, cells were harvested and plated in parallel for viability assays, colony formation assays and immunoblotting.</p><p>Growth and colony formation assays. For cell viability assays, 500-1000 cells were plated in 96-well cell culture plates (Nalgene Nunc) in six replicates, and allowed to grow for various time points. The number of cells present at the time of seeding was recorded as day zero reading (T=0). Cell viability was measured using CellTiter-Glo (Promega) according to manufacturer’s instructions. Luminescence was read using Pherastar plate reader. For colony formation assays, cells were plated in a 6-well dish (1000 cells/well) in triplicate and cultured for 10-14 days. Selection media was replenished every 2-3 days. Colonies were washed with 1X PBS and visualized by staining with 0.5% crystal violet in 10% methanol. Quantification of colonies was done using ImageJ software.</p><p>Immunoblotting. Cells were lysed in RIPA buffer (Invitrogen) containing 1% Halt protease/phosphatase inhibitor cocktail (Pierce, Thermo Scientific). Lysates were suspended in 1X loading buffer containing 10mM DTT and boiled at 95˚C for 10 min. Proteins (50g/lane) were separated on Tris-acetate polyacrylamide gels (Invitrogen) and then transferred onto Hybond-P polyvinylidene diflouride membrane (Immobilon-FL, Millipore). Membranes were incubated for 1 hr with Odyssey Blocking Buffer (Li-Cor) and treated with primary antibodies overnight at 4˚C. The following primary antibodies were used at the indicated dilution: SMARCA4 1:500 (Abcam, 108318), SMARCA2 1:1000 (Abcam, 15597), HA-Tag 1:1000 (Cell Signaling, 2367), α-Tubulin 1:2000 (Cell signaling, 3873). Membranes were treated with secondary antibodies, anti-Rabbit IgG (Li-Cor, 926- 32211) conjugated with IRDye 800CW (green fluorophore) or anti-Mouse IgG (Li- Cor, 926-68020) conjugated with IRDye 680 (Red fluorophore). Antibodies were detected using Odyssey Infrared Imaging system following manufacturer’s instructions (Li-Cor). Proteins were quantified using the Odyssey software and -Tubulin was used as a loading control.</p><p>BROMOScan binding assays. All BROMOScan data was generated by DiscoveRx. Protocols have been adapted from KINOMEscan technology described previously (31). Briefly, T7 phage strains tagged with bromodomains were grown in 24-well blocks in an E. coli host derived from the BL21 strain. E. coli were grown to log-phase and infected with T7 phage from a frozen stock (multiplicity of</p><p>7 Vangamudi et al. (Supplementary Information) infection= 0.4) and incubated with shaking at 32°C until lysis (90-150 minutes). The lysates were centrifuged (5,000 x g) and filtered (0.2μM) to remove cell debris. Streptavidin-coated magnetic beads were treated with biotinylated small-molecule or acetylated peptide ligands for 30 minutes at room temperature to generate affinity resins for bromodomain assays. The liganded beads were blocked with excess biotin and washed with blocking buffer (SeaBlock (Pierce), 1 % BSA, 0.05 % Tween 20, 1 mM DTT) to remove unbound ligand and to reduce non-specific phage binding. Binding reactions were assembled by combining bromodomains, liganded affinity beads, and test compounds in 1x binding buffer (17% SeaBlock, 0.33x PBS, 0.04% Tween 20, 0.02% BSA, 0.004% Sodium azide, 7.4 mM DTT). Test compounds were prepared as 1000X stocks in 100% DMSO and subsequently diluted 1:10 in monoethylene glycol (MEG) to create stocks at 100X the screening concentration (resulting stock solution is 10%DMSO/90% MEG). The compounds were then diluted directly into the assays such that the final concentration of DMSO and MEG were 0.1% and 0.9%, respectively. All reactions were performed in polystyrene 96-well plates in a final volume of 0.135 ml. The assay plates were incubated at room temperature with shaking for 1 hour and the affinity beads were washed with wash buffer (1x PBS, 0.05% Tween 20). The beads were then re-suspended in elution buffer (1x PBS, 0.05% Tween 20, 2 μM non-biotinylated affinity ligand) and incubated at room temperature with shaking for 30 minutes. The bromodomain concentration in the eluates was measured by quantitative PCR. Kds were determined using a compound top concentration = 10,000 nM. If the initial Kd determined was < 0.169 nM (the lowest concentration tested), the measurement was repeated with a serial dilution starting at a lower top concentration. Binding constants (K ds) were calculated with a standard dose-response curve using the Hill equation: Response = Background + Hill Slope Hill Slope [Signal – Background/ 1 + (Kd / Dose ]. The Hill Slope was set to -1. Curves were fitted using a non-linear least square fit with the Levenberg-Marquardt algorithm. </p><p>In-situ cell extraction assay. The GFP-tagged SMARCA2 bromodomain construct used to establish stable cell line for chromatin extraction assay was generated by cloning the SMARCA2 bromodomain sequence (amino acid N1379-E1511 of full-length SMARCA2) into pLVX puromycin vector with NLS sequence (5’-atggatccgaagaaaaaacgtaaaggccgt-3’) at the C-terminus and GFP-tag at the N-terminus. HeLa cells were transduced with GFP-tagged SMARCA2 bromodomain construct using methods described above, and stable cells were generated following puromycin selection (1 µg/ml). Cells were seeded (20,000 cells per well) into 96-well plates (Corning Costar 3603) and grown overnight. The next day, a 16-point 2-fold serial dilution of PFI-3 was prepared in DMSO and diluted into media. Cells were treated in dose-response starting with a top concentration of 300 µM for 2h or 24h. Chromatin binding was induced by SAHA treatment (10 μM) for 2 h. For JQ1 compound treatment, Hela cells stably expressing GFP-tagged full-length BRD4 were plated and dosed as described above starting with a top concentration of 100uM for 30 min. Plates were washed with PBS (150µl per well) and with freshly prepared ice-cold cytoskeleton buffer (CSK). Extraction was performed by incubating cells in 100ul of 0.5% TritonX100 in CSK for 5 min at 40C, followed by fixation in 4% paraformaldehyde for 10 min. For GFP-conjugated constructs, we directly proceeded to imaging. For endogenous proteins,</p><p>8 Vangamudi et al. (Supplementary Information) immunofluorescence (IF) was performed following standard protocols. Briefly, A549 cells treated with compound (PFI-3 or JQ1) or cells with stable knockdown of endogenous SMARCA2 (shSMARCA2) protein were incubated with blocking solution for 30 min. Cells were incubated with primary antibodies, SMARCA2 1:250 (Abcam, ab15597) BRD4 1:200 (Abcam ab128874) or Histone H3 1:4000 (Active Motif, 39763) for overnight at 40C, followed by incubation with donkey anti-rabbit (Alexa 488) and anti-mouse (Alexa647) secondary antibodies (Invitrogen) for 1 hr at 370C. Hoechst 3342 was used as counterstain. Image analysis was performed using High Content Screening System (Operetta, PerkinElmer). For each well, images (20 x magnifications; 9 non-overlapping fields) were captured using filters corresponding to the fluor-conjugates used in the experiment. Analysis was performed using Harmony software by selecting nuclei and cytoplasm in Hoechst channel. Gating for single cells with flat morphology was done based on nuclei area, roundness and intensity of Hoechst in the nucleus and cytoplasm. For each cell, we calculated a value of “nuclear signal”, which corresponded to “intensity of fluorescence signal in nucleus minus intensity of fluorescence signal in cytoplasm”. This value was averaged per cell. </p><p>PFI-3 inhibitor studies. To determine the effect of PFI-3, NSCLC, synovial sarcoma, and rhabdoid cancer cells were seeded at 1000-5000 cells per well in a 96-well plate. The next day, 10-point serial dilution (2 or 3-fold) of the compound was prepared in growth media and cells were treated with PFI- 3 in dose-response. Cells were assayed 72 h (NSCLC, rhabdoid) or 96 hr (synovial sarcoma) following compound treatment using CellTiter-Glo (Promega) as previously described. Relative cell growth was measured as a percentage of day zero reading normalized to control and fitted in PRISM to generate dose response curves and IC50 values. For long-term assays, cells were seeded at a density of 10^5 cells/well in a 12-well dish in triplicate and treated with 3, 10, 30 M compound. Viable cell number was determined every 3–4 days for up to 14 days using Cellometer Cell Viability Counter (Nexcelom) according to the manufacturer’s protocol. On days of cell counts, cells were split and replenished with fresh growth media and PFI-3 inhibitor. Total cell number is expressed as split-adjusted viable cells per well (proliferation curve). For colony formation assays, cells were seeded at 1000 cells per well in a 6-well dish in triplicates and treated with PFI-3 in dose response starting with 40 M top concentration. Cells were replenished with compound every 3-4 days and allowed to grow for 10-14 days. Colonies were stained and visualized with crystal violet as described above.</p><p>Real-time quantitative PCR. Cells were plated in triplicate in 10 cm plates at 5X10^5 cells/plate in a final volume of 10ml. Cells were incubated in the presence of different drug concentrations for 3 or 6 days. In 6 day treatment experiments, cells were split and replenished with fresh media and drug after 3 days. RNA from cells was isolated using RNeasy Plus Mini Kit (Qiagen, 74134) according to the manufacturer’s protocol. 1µg of total RNA was reverse transcribed per reaction using a high capacity cDNA reverse transcription kit (Applied Biosystems, 4368814) according to the manufacturer’s protocol. TaqMan gene expression assays for Sox2 (Hs01053049_s1) and GAPDH (Hs02758991_g1) were purchased from Applied Biosystems. qPCR reactions were performed using the TaqMan universal PCR master mix (Applied Biosystems) and TaqMan gene expression assays along with equal 9 Vangamudi et al. (Supplementary Information) relative amounts of cDNA from each sample. qPCR reactions were run on a Viia7 Real Time PCR machine (Applied Biosystems) with cycling conditions of 2 min at 50°C, 10 min at 95°C, 45 cycles at 15 sec at 95°C and 1 min at 60°C. Minus-RT sample was used as a negative control for each assay. Target gene cycle numbers were normalized to the house keeping gene GAPDH to get a ΔCT value. Percentage of DMSO-treated control was calculated with the equation (2^-ΔΔCT)*100 where the ΔΔCT is the difference between normalized target gene and DMSO-treated control (ΔΔCT =ΔCT sample – ΔCT control).</p><p>Chromatin immunoprecipitation (ChIP). Cells were plated in multiple 150 mm dishes and were incubated in the presence of different drug concentrations for 3 days. Cell lines were fixed in 1% formaldehyde for 10 minutes at 25°C. After lysis, samples were sonicated using a chilled bath sonicator (Bioruptor; Diagenode) for 60 cycles (30 seconds per cycle/30 seconds cooling) at a high power level. Chromatin sheering was optimized to a size range of 200 to 600 bp. Chromatin (50 μg) was immunoprecipitated with antibodies for BRG1 (2ug; Abcam ab4081 Lot GR152466-1), rabbit IgG (2ug; Invitrogen 026102 Lot 1461621A), or RNA PolII (1ug; Covance MMS-126R).</p><p>Primer sequences used are as follows:</p><p>Gene Sequence (5'----3') hSOX2-ChIP-Promoter F GAG AAG GGC GTG AGA GAG TG hSOX2-ChIP-Promoter R AAA CAG CCA GTG CAG GAG TT hSOX2 TF1 For_ChIP AAA CAG AGC TTT CCC CCA AT hSOX2 TF1 Rev_ChIP TTG AGT GTG TTC CCC TCC TC</p><p>MyoD1-Chip-F CCGCCTGAGCAAAGTAAATGA</p><p>MyoD1-Chip-R GGCAACCGCTGGTTTGG</p><p>GAPDH-Chip-F TACTAGCGGTTTTACGGGCG</p><p>GAPDH-Chip-R TCGAACAGGAGGAGCAGAGAGCGA</p><p>SMARCA4 cDNA complementation assay. A549 cells were transduced with dox-inducible GFP control, wild-type or mutant SMARCA4 cDNA using the protocol described above, and stable cell lines were generated following selection with neomycin (600 µg/ml). For siRNA mediated knockdown of SMARCA2, A549 cells stably expressing control or wild-type SMARCA4 cDNA were treated with doxycyline (0.5 µg/ml) for 3-4 days, and plated in a 6-well dish (10,000 per well). The next day, cells were transfected with 25 nM of SMARCA2 (Supplementary Table S3) or control siRNA (catalog number) using Dharmafect-I in a final volume of 2mL, following manufacturer’s protocol (Thermo</p><p>10 Vangamudi et al. (Supplementary Information)</p><p>Scientific). Media was changed 24 h post-transfection and cells were allowed to recover. The following day cells were harvested and seeded into 6-well dish for a second round of transfection. 24 h post transfection, cells were re-plated in a 6-well dish for colony formation assay (1000 cells/well) or for western blotting. Colony formation was assessed after 10-14 days, and proteins were analyzed 5-days post-transfection for SMARCA2 knockdown and SMARCA4 overexpression. For shRNA mediated knockdown, dox-induced stable cell lines expressing GFP, wild-type, bromodomain mutant or ATPase dead SMARAC4 cDNA were transduced with control (shLuc) or SMARCA2 shRNA (shSMARCA2) as described previously. At 72-h post puromycin selection, cells were plated for colony formation and western blotting following protocols described earlier.</p><p>SMARCA2 cDNA rescue experiment. SMARCA2 (GeneCopoeia Catalog #GC-Z4424) human cDNA was cloned into lentiviral expression vector. Point mutations in SMARCA2 constructs were introduced by site-directed mutagenesis using established protocols. Stable cell lines were generated by transducing H1299 cells with HA-tagged dox-inducible wild-type, bromodomain mutant (N1482W), or ATPase dead mutant (K755A) SMARCA2 cDNA. Rescue experiment was performed following methods described for complementation assay. Briefly, cells were treated with doxycyline (0.5 µg/ml) for 3-4 days, and plated in a 6-well dish for infection with control (shLuc) or SMARCA2 shRNA (shSMARCA2- 7) that targets the 3’UTR. Starting 72 h post puromycin selection, cells were plated for colony formation and western blotting analyzed as described above. The gene set enrichment analysis (GSEA) was carried out using the GSEA package and genesets from the mSigDB. Query sets based on both 2-class comparison and ranked lists based on p-value and the direction of fold changes, were used as inputs to the GSEA analysis, as appropriate.</p><p>Microarray analysis (mRNA expression profiling). GeneChip Human genome U133 plus 2.0 arrays (Affymetrix, PN 900467), containing more than 54,000 probe sets of analyzing the relative expression level of more than 47,000 transcripts and variants including more than 38,500 wellcharacterized genes and UniGenes, were used for gene expression profiling of this study. Sample labeling and processing, GeneChip hybridization, and scanning were performed according to Affymetrix protocols. Briefly, double-stranded cDNA was synthesized from total RNA with the GeneChip 3’ IVT plus kit (Affymetrix, PN 902416), with a T7 RNA polymerase promoter site added to its 3′ end (Genset, La Jolla, CA). Biotinylated cRNAs were generated from in vitro transcription (IVT) using T7 promotor containing cDNAs as templates for 16 hours at 37°C. The purified biotin-cRNAs were fragmented at 94°C for 35 min. Approximately 12.5 μg of fragmented cRNA was used in a 250-μl hybridization mixture containing herring-sperm DNA (0.1 mg/ml; Promega), plus bacterial and phage cRNA controls (1.5 pM BioB, 5 pM BioC, 25 pM BioD, and 100 pM Cre) to serve as internal controls for hybridization efficiency. Aliquots (200 μl) of the mixture were hybridized to arrays for 16 h at 45°C in a GeneChip Hybridization Oven 640 (Affymetrix). Each array was washed and stained with streptavidin– phycoerythrin (Invitrogen) and amplified with biotinylated anti-streptavidin antibody (Vector Laboratories) on the GeneChip Fluidics Station 450 (Affymetrix). Arrays were scanned with the GeneArray G7 scanner (Affymetrix) to obtain image and signal intensities. The expression data 11 Vangamudi et al. (Supplementary Information) generated were processed using Affy (1) and LIMMA (2) Bioconductor packages using the R- programming environment. The gene expression profiles were normalized using the RMA algorithm and the differential expression was identified using empirical Bayes method followed by Benjamini- Hochberg multiple hypothesis correction (3). For SMARCA2 rescue experiments two-factorial models were built to identify interaction of shRNA mediated knockdown with genetic rescue using various SMARCA2 variants.</p><p>Reference</p><p>1. Gautier L, Cope L, Bolstad BM and Irizarry RA (2004). “affy—analysis of Affymetrix GeneChip data at the probe level.” Bioinformatics, 20(3), pp. 307–315. ISSN 1367-4803</p><p>2. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W and Smyth GK (2015). “limma powers differential expression analyses for RNA-sequencing and microarray studies.” Nucleic Acids Research, 43(7), pp. e47.</p><p>3. Benjamini, Yoav; Hochberg, Yosef (1995). "Controlling the false discovery rate: a practical and powerful approach to multiple testing" (PDF). Journal of the Royal Statistical Society, Series B 57 (1): 289–300.</p><p>12</p>
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages12 Page
-
File Size-