2Thomas Jefferson High School for Science and Technology, 6560 Braddock Road, Alexandria

2Thomas Jefferson High School for Science and Technology, 6560 Braddock Road, Alexandria

<p>A VEGFR-3 Antagonist Increases IFN-γ Expression on Low Functioning NK Cells in Acute Myeloid Leukemia</p><p>Ji Yoon Lee,1 Sohye Park,1 Donghyun Curt Kim,2 Jae-Ho Yoon,1 Seung Hwan Shin,1 Woo-Sung Min,1 Hee-Je</p><p>Kim1, 3</p><p>1Department of Hematology, Catholic Blood and Marrow Transplantation Center, College of Medicine, The</p><p>Catholic University of Korea, Seoul, Korea</p><p>2Thomas Jefferson High School for Science and Technology, 6560 Braddock Road, Alexandria, VA 22312, USA</p><p>3Correspondence: [email protected]</p><p>Correspondence: Hee-Je Kim, M.D, Ph.D </p><p>Division of Hematology, Department of Internal Medicine </p><p>Catholic Blood and Marrow Transplantation Center</p><p>Seoul St. Mary’s Hospital, College of Medicine </p><p>The Catholic University of Korea </p><p>505 Banpo 4-dong, Seocho-gu</p><p>Seoul 137-701, Korea</p><p>Telephone; 82-2-2258-6054 Fax; 82-2-599-3589</p><p>E-mail: [email protected] Patients and methods</p><p>Human samples</p><p>Twenty eight MNC samples from AML patients were used for the PCR experiments (Fig. 1a). CD56 sorting</p><p>(Fig. 2a) was performed using nineteen MNC samples from AML patients. For FACS analysis, thirty seven</p><p>MNC samples (Fig. 1b and Fig. 2b, respectively) from AML patients were used. Immunocytochemistry was performed using three PB-MNC samples (Fig. 2c), and cytotoxicity against K562 cells was tested with eighteen</p><p>PB-MNC samples from AML patients (Fig. 3a). Fifteen PB-MNC samples from AML patients were prepared separately and used for the detection of IFN-γ as shown in Figures 3b and 4, respectively. The clinical characteristics and experimental information regarding the patients with AML enrolled in the present study are listed in Table 1. </p><p>Cytotoxicity assay</p><p>CD56+ (NK) cells (4.5 × 104) from the PB-MNCs of patients with AML were purified using magnetic-activated cell sorting (MACS, 130-092-657; Miltenyi Biotec, Bergisch Gladbach, Germany) and used as effector cells in a cytotoxicity assay. K562 erythroleukemic cells, which lack human leukocyte antigen (HLA) class I antigens, were used as target cells. CD56+ cells from healthy donors were used as a control. The target cells were labeled with BATDA solution (DELFIA® cytotoxicity assay; PerkinElmer, Waltham, MA, USA) for 10 min, washed twice, and placed into 96-well V-bottom plates at approximately 5 × 103 target cells per well. Effector cells were added to the wells at a 10:1 effector-to-target cell ratio and incubated for at least 3 h. After the reaction, the supernatants were collected and reacted with europium solution for 5 min. Fluorescence intensity was measured using an EnVision system. Cytotoxicity was calculated as follows: percentage of target cell lysis = [(cpm of experimental release − cpm of spontaneous release)/(cpm of maximum release − cpm of spontaneous release)] ×</p><p>100. At least four independent experiments were performed in duplicate. </p><p>Supplementary Figure 1 FACS analysis. To distinguish NK cells from CD56+ AML cells, we confirmed that functional CD56+ NK cells exist in lymphocyte gating using CD45+ expression. Healthy NK cells were expressed CD45+CD56+ phenotype, while AML blasts were expressed CD45-/dim. Supplementary Figure 2 Expression of IFN-γ and VEGFR-3 expression in healthy NK cells with feeder cells. a Healthy NK cells were co-cultured with VEGF-C-producing HUVECs and demonstrated that IFN-γ production was overall decreased in CD56+CD3- NK cells.</p><p>Most of IFN-γ expression was enriched in VEGFR-3+ cell. In contrast, co-cultured NK cells without feeders or with HEK293 cells, showed no increase in VEGFR-3 expression and high level IFN-γ expression compared to HUVEC co-cultured condition, suggesting that VEGF-</p><p>C/VEGFR-3 axis may be involved in lytic properties. b Statistical analysis for the percentage of VEGFR-3+ and VEGFR-3- cells in IFN-γ expressing NK cells. Results were expressed from eight independent experiments. The asterisks depict statistically significance in</p><p>VEGFR-3+ cell groups. **P < 0.01 vs. VEGFR-3- cells.</p><p>Supplementary Table 1. Primers and probes for quantitative RT-PCR</p><p>Genes Primers and probes (5'-3') human GAPDH Forward GGTGGTCTCCTCTGACTTCAACA Reverse GTGGTCGTTGAGGGCAATG Probe CCACTCCTCCACCTTTGACGCTGG human VEGFR3 Forward CCTTGCCCGGGACATCTA Reverse TTGTCGAAGATGCTTTCAGGG Probe AGACCCCGACTACGTCCGCAAGG human LYVE-1 Forward CTGGGTTGGAGATGGATTCG Reverse TCAGGACACCCACCCCATTT Probe TAGCCCAAACCCCAAGTG human Podoplanin Forward CAGGTGCCGAAGATGATGTG Reverse TGTTGCCACCAGAGTTGTCA Probe TGACTCCAGGAACCAG human PROX1 Forward GCCAGATTTGCAGTCAATGG Reverse ATGATGACGTCGCCAAAGC Probe TTTCCACACCGCCAAC human IFN-gamma Forward ACTCATCCAAGTGATGGCTGAA Reverse TCCTTTTTCGCTTCCCTGTTT Probe TGTCGCCAGCAGCT human Granzyme B Forward GGCCCCCCTGGGAAA Reverse TCTTCCTGCACTGTCATCTTCAC Probe CACTCACACACACTACAA human Perforin Forward TGTCGAGGCCCAGGTCAA Reverse CCTTGGCTTCGGCAGAGAT Probe ATAGGCATCCACGGCAG human TNF-alpha Forward GGAGAAGGGTGACCGACTCA Reverse CAGACTCGGCAAAGTCGAGATA Probe CTGAGATCAATCGGC </p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    6 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us