<p>A VEGFR-3 Antagonist Increases IFN-γ Expression on Low Functioning NK Cells in Acute Myeloid Leukemia</p><p>Ji Yoon Lee,1 Sohye Park,1 Donghyun Curt Kim,2 Jae-Ho Yoon,1 Seung Hwan Shin,1 Woo-Sung Min,1 Hee-Je</p><p>Kim1, 3</p><p>1Department of Hematology, Catholic Blood and Marrow Transplantation Center, College of Medicine, The</p><p>Catholic University of Korea, Seoul, Korea</p><p>2Thomas Jefferson High School for Science and Technology, 6560 Braddock Road, Alexandria, VA 22312, USA</p><p>3Correspondence: [email protected]</p><p>Correspondence: Hee-Je Kim, M.D, Ph.D </p><p>Division of Hematology, Department of Internal Medicine </p><p>Catholic Blood and Marrow Transplantation Center</p><p>Seoul St. Mary’s Hospital, College of Medicine </p><p>The Catholic University of Korea </p><p>505 Banpo 4-dong, Seocho-gu</p><p>Seoul 137-701, Korea</p><p>Telephone; 82-2-2258-6054 Fax; 82-2-599-3589</p><p>E-mail: [email protected] Patients and methods</p><p>Human samples</p><p>Twenty eight MNC samples from AML patients were used for the PCR experiments (Fig. 1a). CD56 sorting</p><p>(Fig. 2a) was performed using nineteen MNC samples from AML patients. For FACS analysis, thirty seven</p><p>MNC samples (Fig. 1b and Fig. 2b, respectively) from AML patients were used. Immunocytochemistry was performed using three PB-MNC samples (Fig. 2c), and cytotoxicity against K562 cells was tested with eighteen</p><p>PB-MNC samples from AML patients (Fig. 3a). Fifteen PB-MNC samples from AML patients were prepared separately and used for the detection of IFN-γ as shown in Figures 3b and 4, respectively. The clinical characteristics and experimental information regarding the patients with AML enrolled in the present study are listed in Table 1. </p><p>Cytotoxicity assay</p><p>CD56+ (NK) cells (4.5 × 104) from the PB-MNCs of patients with AML were purified using magnetic-activated cell sorting (MACS, 130-092-657; Miltenyi Biotec, Bergisch Gladbach, Germany) and used as effector cells in a cytotoxicity assay. K562 erythroleukemic cells, which lack human leukocyte antigen (HLA) class I antigens, were used as target cells. CD56+ cells from healthy donors were used as a control. The target cells were labeled with BATDA solution (DELFIA® cytotoxicity assay; PerkinElmer, Waltham, MA, USA) for 10 min, washed twice, and placed into 96-well V-bottom plates at approximately 5 × 103 target cells per well. Effector cells were added to the wells at a 10:1 effector-to-target cell ratio and incubated for at least 3 h. After the reaction, the supernatants were collected and reacted with europium solution for 5 min. Fluorescence intensity was measured using an EnVision system. Cytotoxicity was calculated as follows: percentage of target cell lysis = [(cpm of experimental release − cpm of spontaneous release)/(cpm of maximum release − cpm of spontaneous release)] ×</p><p>100. At least four independent experiments were performed in duplicate. </p><p>Supplementary Figure 1 FACS analysis. To distinguish NK cells from CD56+ AML cells, we confirmed that functional CD56+ NK cells exist in lymphocyte gating using CD45+ expression. Healthy NK cells were expressed CD45+CD56+ phenotype, while AML blasts were expressed CD45-/dim. Supplementary Figure 2 Expression of IFN-γ and VEGFR-3 expression in healthy NK cells with feeder cells. a Healthy NK cells were co-cultured with VEGF-C-producing HUVECs and demonstrated that IFN-γ production was overall decreased in CD56+CD3- NK cells.</p><p>Most of IFN-γ expression was enriched in VEGFR-3+ cell. In contrast, co-cultured NK cells without feeders or with HEK293 cells, showed no increase in VEGFR-3 expression and high level IFN-γ expression compared to HUVEC co-cultured condition, suggesting that VEGF-</p><p>C/VEGFR-3 axis may be involved in lytic properties. b Statistical analysis for the percentage of VEGFR-3+ and VEGFR-3- cells in IFN-γ expressing NK cells. Results were expressed from eight independent experiments. The asterisks depict statistically significance in</p><p>VEGFR-3+ cell groups. **P < 0.01 vs. VEGFR-3- cells.</p><p>Supplementary Table 1. Primers and probes for quantitative RT-PCR</p><p>Genes Primers and probes (5'-3') human GAPDH Forward GGTGGTCTCCTCTGACTTCAACA Reverse GTGGTCGTTGAGGGCAATG Probe CCACTCCTCCACCTTTGACGCTGG human VEGFR3 Forward CCTTGCCCGGGACATCTA Reverse TTGTCGAAGATGCTTTCAGGG Probe AGACCCCGACTACGTCCGCAAGG human LYVE-1 Forward CTGGGTTGGAGATGGATTCG Reverse TCAGGACACCCACCCCATTT Probe TAGCCCAAACCCCAAGTG human Podoplanin Forward CAGGTGCCGAAGATGATGTG Reverse TGTTGCCACCAGAGTTGTCA Probe TGACTCCAGGAACCAG human PROX1 Forward GCCAGATTTGCAGTCAATGG Reverse ATGATGACGTCGCCAAAGC Probe TTTCCACACCGCCAAC human IFN-gamma Forward ACTCATCCAAGTGATGGCTGAA Reverse TCCTTTTTCGCTTCCCTGTTT Probe TGTCGCCAGCAGCT human Granzyme B Forward GGCCCCCCTGGGAAA Reverse TCTTCCTGCACTGTCATCTTCAC Probe CACTCACACACACTACAA human Perforin Forward TGTCGAGGCCCAGGTCAA Reverse CCTTGGCTTCGGCAGAGAT Probe ATAGGCATCCACGGCAG human TNF-alpha Forward GGAGAAGGGTGACCGACTCA Reverse CAGACTCGGCAAAGTCGAGATA Probe CTGAGATCAATCGGC </p>