<p> miR159* miR159 miR157* miR157 miR156* miR156 miR396 miR390* miR390 miR171* miR171 miR168* miR168 miR167* miR167 miR166* miR166 miR166* miR166 miR165* miR165</p><p> miRNA type ath-miR396a S-ath-MIR390a ath-miR390a S-osa-MIR171d osa-miR171b cmelo-mir168* ath-miR168a S-ath-MIR167d ptc-miR167f Csat-miR*166X sbi-miR166a Csat-miR*166Y sbi-miR166a S-ath-MIR165a ath-miR165a S-ptc-MIR159c ath-miR159b S-ath-MIR157d ath-miR157d S-ptc-MIR156j zma-miR156j</p><p>Probe_ID ` UCGGACCAGGCUUCAUUCCC UCGGACCAGGCUUCAUUCCC GGGGAAUGUUGUCUGGAUCGAG UCGGACCAGGCUUCAUCCCCC UGGAGCUCCUUGAAGUCCAAUA UUUGGAUUGAAGGGAGCUCUU AUGUGCUCUCUAUGCUUCUGUC UGACAGAAGAUAGAGAGCAC UGUGCUCUCUAUGCUUCUGUCA UGACAGAAGAGAGAGAGCACA probed_Sequence UUCCACAGCUUUCUUGAACUG UGGCGCUAUCCAUCCUGAGUUU AAGCUCAGGAGGGAUAGCGCC GAUGUUGGCCCGGCUCACUCAG UGAUUGAGCCGUGCCAAUAUC CCCGCCUUGCAUCAACUGAAU UCGCUUGGUGCAGGUCGGGAA UACUAGGUCAUCCUGCAGCUUC UGAAGCUGCCAGCAUGAUCUU GGAAUGUUGGCUGGCUCGAGG GGAAUGUUG U CUGGCUCGAGG ` 21 22 21 22 21 21 21 22 21 21 20 21 20 22 21 22 21 22 20 22 21 length Average Accumulation ratio FRNK/FINK 12.8 10.1 11.2 19.7 3.42 2.5 1.2 1.3 6.8 3.3 Relative SEM 0.3 0.0 0.2 1.1 3.5 4.8 2.7 7.6 0.6 0.6 ± 2+1+1 1+1 1+1 2+1 2+1</p><p>1 1 1 2 1 3 Nucleotides in mismatch stretch(es) 0 0 0 0 1 0 2 0 0 1 1 Bulges mFold Supplemental Figure 1. Selected sequences detected on microarrays of Figure 2 and on northern-blots of Figure 3.</p><p>Array was hybridized with low molecular weight RNA from plants infected with Zucchini yellow mosaic virus (ZYMV) severe (ZYMVFRNK) or mild (ZYMVFINK) strains at 5 dpi. Shown in table are sequences which accumulated the highest ZYMVFRNK signal on the microarray for each type member (2), regardless of source organism, except for miR166* (grey boxes), where 2 slightly different sequences, (differences underlined) are shown. Data shown in Figures 2 and 3 are for Csat-miR*166Y. FRNK/FINK relative accumulation column were calculated from the averages [±Standard error of means (SEM)] of normalized miRNA* values at 5 dpi of three biological replicate microarrays. mFold (1) structures were computed from array probe sequence data constructed in an artificial stem loop structure with artificial spacer and flanking nucleotides (erased for clarity). Non-canonical G-U pairing was counted as a match. Bulges were counted as such only when duplex helix structure was altered by an insertion or a deletion. zma=Zea maize; ptc=Populus trichocarpa; ath=Arabidopsis thaliana; osa=Oryza sativa; csat=Cucumis sativus; cmelo=Cucumis melo.</p><p>1. Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31:3406-15.</p><p>2. http://microrna.sanger.ac.uk/</p>
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages2 Page
-
File Size-