Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Occlusion of the HIV poly(A) site Caroline Weichs an der Glon, Joan Monks, and Nick J. Proudfoot Sir William Dunn School of Pathology, University of Oxford, Oxford OXl 3RE UK To investigate the selective use of poly{A) sites in the 3' long terminal repeat (LTR) but not the 5' LTR of retroviruses, we have studied the poly (A) site of the human immunodeficiency virus (HIV-1). Using hybrid HIV/a-globin gene constructs, we demonstrate that the HIV poly(A) site is inactive or occluded when adjacent to an active promoter, either the homologous HIV promoter or the a-globin gene promoter. Furthermore, this occlusion of the HIV poly(A) site occurs over a considerable distance of up to at least 500 bp. In contrast, two nonretroviral poly(A) sites [a-globin and a synthetic poly{A) site] are active when close to a promoter. We also show that a short fragment of -60 nucleotides containing the HIV poly(A) site is fully active when placed at the 3' end of the human a-globin gene or within the rabbit p-globin gene. This result rules out the requirement of more distant upstream elements for the activity of the HIV poly(A) site, as has been suggested for other viral poly(A) sites. Finally, we show that the GT-rich downstream region of the HIV poly(A) site confers poly{A) site occlusion properties on a synthetic poly(A) site. This result focuses attention on this more variable part of a poly(A) site in retrovirvses as a possible general signal for poly(A) site occlusion. [Key Words: Poly(A) sites; HIV-1; LTRs; retroviral transcription] Received August 9, 1990; revised version accepted November 26, 1990. The duplication of transcriptional control sequences in cessing signal is absent from the transcript. However, the long terminal repeats (LTRS) of retroviruses presents more commonly, the poly(A) signals of retroviruses are unusual regulatory features. The promoter in the 5' LTR 50-100 bp 3' to the transcription start site so that the initiates transcription that reads through the adjacent whole RNA processing signal should be within the RNA poIy(A) site into the viral genes beyond. Transcription transcript (Varmus 1988). then proceeds into the 3' LTR forming a polyadenylated Such is the situation in the human immunodeficiency 3' terminus at the identical poly(A) site in the 3' LTR. As virus HIV-1, where the transcription start site is 72 bp 5' shown in Figure lA, this pattern of transcription is to the poly(A) signal (Fig. IB) (Ratner et al. 1987). Both achieved by somehow inactivating both the poly(A) site the high levels of transcription achieved by HIV, as well in the 5' LTR and the promoter in the 3' LTR even as the intense interest in characterizing the molecular though identical copies of these two transcription sig­ mechanisms that regulate it, prompted us to investigate nals are highly active in the opposite LTR (Varmus HIV poly(A) site occlusion in more detail. To do this, we 1988). have set up a model system by making hybrid HIV LTR/ A molecular explanation for the inactivity of the 3' human a2-globin gene constructs with the LTR in place LTR promoter may be that of transcriptional interfer­ of the a-globin promoter, as well as positioned at the 3' ence. Cullen et al. (1984) demonstrated that in the avian end of the a-globin gene. Using these constructs, we leukosis retrovirus (ALV), transcription from the 5' LTR demonstrate both poly(A) site occlusion in the 5' LTR directly inactivates the 3' LTR promoter. This inactiva- and transcriptional interference in the 3' LTR. We have tion could be alleviated by either deleting the 5' LTR gone on to characterize the poly(A) site occlusion more promoter or by placing SV40 termination of transcrip­ thoroughly. First, the HIV poly(A) site functions effi­ tion signals between the two LTRs. Presumably, tran­ ciently when separated from its adjacent promoter and scription reading into the 3' LTR blocks the formation of placed either at the 3' end of the a-globin gene or within a transcription initiation complex, as has been shown in the rabbit p-globin gene. However, the HIV poly(A) site RNA polymerase I genes (Bateman and Paule 1988; does not function significantly when positioned imme­ Henderson et al. 1989). diately 3' to an active promoter, either its homologous The molecular basis of retroviral poly(A) site occlusion HIV promoter or the a-globin promoter. Second, in con­ is uncharacterized. In some cases, such as the Rous sar­ trast with the HIV poly(A) site, other poly(A) sites are coma virus (Ju and Cullen 1985), the transcription initi­ active when adjacent to either the HIV or a-globin pro­ ation site lies between the two parts of the poly(A) sig­ moters. Our results suggest that the HIV poly(A) site nal: the A2UA3 and GU-rich sequence elements (Hum­ and, in particular, its downstream GT-rich region pos­ phrey and Proudfoot 1988). Consequently, the 5' LTR sess specific sequence features that render it sensitive to poly(A) site is inactive because the complete RNA pro­ transcription from an immediately adjacent promoter. 244 GENES & DEVELOPMENT 5:244-253 © 1991 by Cold Spring Harbor Laboratory ISSN 0890-9369/91 $1.00 Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Occlusion of HIV poly(A) site © 0 0 © pA pA r \/ viral gene r V DMA LTR iin)i>))))iiTTTT--'-nniiinnmii-TnT. LTR Figure 1. [A] Schematic illustration of Transcription transcription in a retroviral system, dem­ 1 onstrating the occlusion of the polyadeny- lation site in the 5' LTR and inActiy&tion RNA of the promoter in the 3' LTR. Active or inactive promoters and poly(A) sites are denoted by + and —, respectively. (B) Se­ quence of the long terminal repeat (LTR) fragment [Ava\-Hini\) obtained from HIV- Aval I 1 -150 -UO -130 -120 -110 -100 -90 -DO 1 (Ratner et al. 1987). The LTR fragment CCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGG contains the HIV-1 LTR promoter/ enhancer region with the TATA box se­ quence underlined and transcription start AGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATAIMGCAGCTGCTTTTTGCCTGTACT site indicated by an arrow. The poly (A) site signals, AATAAA, and two GT-rich re­ gions are boxed, with the site of poly(A) GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTC addition indicated. The inverted repeat re­ I ^ > < , gion that confers Tat responsiveness on the HIV promoter (Cullen and Greene 1989) is indicated by Tar. Finally, various iAATAAAlGGTTGCCTTGAGTGCTTCAABTAGTgl^TgCCCGTCtroTTGTCTm restriction sites employed in these studies T are bracketed. l'oly(A) Results plasmids, and rabbit p-globin mRNA, which provides a useful control for efficiency of transfection (Grosveld et Hybrid HIV LTR/a-globin gene constructs reproduce al. 1982). viral transcriptional regulation Figure 2B shows RNA mapping experiments per­ To set up a convenient experimental system to investi­ formed on cytoplasmic RNA purified from HeLa cells gate poly(A) site occlusion in the HIV LTR sequence, we transfected with either La or LaL pSVed. Panel I shows constructed chimeric DNAs in v^hich portions of the the RNase-protected bands obtained using a riboprobe as HIV LTR v/ere fused to equivalent parts of the human indicated in Figure 2A. La gave one band that corre­ a2-globin gene. Two such constructs were initially in­ sponds to a transcript that initiates at the HIV cap site vestigated, one containing the HIV LTR promoter and and then reads through the HIV poly(A) site into the leader sequence in place of the a-globin promoter region a-globin gene beyond. The HIV poly(A) site would there­ (La) and the other containing a second copy of the HIV fore appear to be inactive in La (see below). LTR sequence in place of the 3' end of the a-globin gene, LaL, as well as giving a 5' LTR readthrough band, gave including its poly(A) signal (LaL). The HIV LTR se­ a second larger product of &. 250 nucleotides, which cor­ quence present in La and LaL starts from an Aval site responds in size to transcripts reading into the 3' LTR (-160) in the 5'-flanking region and includes all of the sequence and then ending at the 3' LTR poly(A) site. No HIV enhancer and promoter elements (Jones 1989). The transcripts were detected that initiate at the 3' LTR pro­ Hinfl site ( +128) at the 3' end of the LTR fragment im­ moter. This 3' LTR readthrough band would be 10 nu­ mediately follows the GT-rich sequences that are part of cleotides larger than the 5' LTR readthrough band be­ the HIV poly(A) signal, as directly demonstrated by cause of polylinker sequences present both in the ribo­ Bohnlein et al. (1989). The HIV LTR sequence is shown probe and 3' LTR sequence but absent from the 5' LTR in Figure IB while La and LaL are depicted in Figures 2A sequence. To confirm the transcription pattern observed and 3A. La and LaL are within the transient expression for the 3' LTR in LaL, a second RNA mapping experi­ vector pSVed (Proudfoot et al. 1984), which contains ment was carried out using an end-labeled DNA probe both the SV40 origin of replication and enhancer se­ specific for the 3' LTR (labeled at an Xbal site in the quences. We have recently discovered that the HIV pro­ polylinker sequence 5' to the 3' LTR; see Fig. 2A). By SI moter is activated by DNA replication (N.J.