<p> SUPPLEMENTARY TABLE 1. Oligonucleotides used in this study.</p><p>Regiona Oligonucleotide Pair Application</p><p>YFR057W oALK552 5’GCCAAGCTTCCAATATCACGA RT-PCR</p><p> oALK553 5’GGAATGATCTTGGAAATCGATCA</p><p>SCR1 oALK402 5’CGCGGCTAGACACGGATT RT-PCR</p><p> oALK403 5’GCACGGTGCGGAATAGAGAA</p><p>ASF1 oALK755 5’ TTCCATTCTGGTAGGCCCC RT-PCR</p><p> oALK756 5’ TTCACTCGCAGGAATCAGCTC</p><p>H4 K16R oALK593 5’GGTGGTGCCAGACGTCACAGAAAGATTCTAAGAG Site-Directed Mutagenesis</p><p> oALK594 5’CTCTTAGAATCTTTCTGTGACGTCTGGCACCACC</p><p>H3 K56R oALK642 5’ GAAGATTCCAAAGATCTACTGAACT Site-Directed Mutagenesis</p><p> oALK643 5’ AGTTCAGTAGATCTTTGGAATCTTC</p><p>H3 K56Q oALK691 5’ GAAGATTCCAACAATCTACTGAACTGTTGATCAG Site-Directed Mutagenesis</p><p> oALK692 5’ CTGATCAACAGTTCAGTAGATTGTTGGAATCTTC</p><p> aSequences of additional oligonucleotides used during strain construction are available upon request.</p><p>1 of 5 SUPPLEMENTARY TABLE 2. Restoration of Silencing at HMRae**.</p><p>Relative Efficiency of Strain Matinga WT 1 asf1 67 ± 21 hir1 0.60 ± 0.33 cdc44-5 14 ± 9.9 pol30-6 42 ± 13</p><p> aIn quantitative mating assays, the efficiency of mating of MAT HMRae** cells to the tester strain JRY4012 (MATa) was determined relative to their plating efficiency (0.13 ± 0.057%, n = </p><p>3), and was set to 1. The mating efficiencies of each strain relative to MAT HMRae** cells was determined as indicated in Materials and Methods. Avg. ± St. Dev., n = 3.</p><p>2 of 5 SUPPLEMENTARY TABLE 3. Hypoacetylation of K56 on Histone H3 Restores Silencing at </p><p>HMRae**.</p><p>HHT2-HHF2 Relative Efficiency of Strain Matinga RTT109 H3/H4 1 RTT109 H3 K56Q/H4 1.3 ± 0.46 RTT109 H3 K56R/H4 8.1 ± 3.2 rtt109 H3 K56R/H4 11 ± 2.3</p><p> aIn quantitative mating assays, the efficiency of mating of MAT HMRae** expressing wild-type histones H3 and H4 to tester strain JRY2726 (MATa) was determined relative to their plating efficiency (4.3 ± 1.4%, n = 3), and was set to 1. The mating efficiencies of each strain relative to </p><p>MAT HMRae** cells expressing wild-type H3 and H4 was determined as indicated in Materials and Methods. Avg. ± St. Dev., n = 3.</p><p>3 of 5</p><p>Supplementary Figure</p><p>Supplementary Fig. 1. Synthetic interaction analyses of silencing of yFR057w at Telomere VIR. A. Synthetic interactions between pol30 and rtt109 mutants. B. Synthetic interactions between pol30 and histone H3 hyper- and hypoacetylation mutants. yFR057w mRNA levels relative to SCR1 (internal control) were determined for each strain by quantitative real-time PCR </p><p>4 of 5 (see Materials and Methods) and expressed relative to mRNA levels in wild-type yeast, which has been set to 1. Data were calculated as follows; 2[(locus CT–SCR1 CT)wild-type – (locus CT – SCR1 CT)a] x 100, where “a” is the indicated genotype. Data was obtained from two independent clones for each genotype, Avg. ± SD, n = 3.</p><p>5 of 5</p>