<p>Analysis of DNA Sequence using an Internet Database</p><p>Kris Flesberg Elmwood High School Summer 2007 Activity Description: </p><p>This activity uses an Internet database to analyze a DNA sequence. It requires some introduction to the site by the instructor, then the students will use the website to answer a few questions, and by the last day the students will be able to explore the website on their own and investigate their own DNA sequence. This is an activity involving previous knowledge of DNA and technology associated with bioinformatics and biotechnology. The students will be brought into the computer lab and will work with the teacher to explore the National Institutes of Health website. The worksheet provided will be made accessible on the schools public folder so the students can cut and paste their answers and DNA sequences. The students will be asked to find the origin of a particular sequence of DNA. They will also be asked to use the program to translate the sequence into an amino acid sequence and identify similarities to other species. Students will create their own DNA sequence and determine its closets relationship to known segments. </p><p>Class: </p><p>I would use this activity with my cell biology and genetics class. This class consists of juniors and seniors. The class is usually small averaging 12 to 15 students.</p><p>Part of class into which project fits:</p><p>This will be used during our unit on DNA. This unit comes after the cell and its organelles and before meiosis and genetics. We would discuss DNA replication, transcription and translation. Once the students have a thorough understanding of these topics I would introduce this activity. This is a class that I am currently developing and changing. In order to make room for this activity I would mostly likely spend less time on energy in the cell since it is covered in great length in sophomore biology, which is a prerequisite for this course. </p><p>Length of activity:</p><p>In my school district this class would meet everyday for 45 minutes for the duration of one semester. I expect this activity to take up two full class periods. </p><p>Outline of activity:</p><p>The objective of this activity it to integrate technology into my cell biology and genetics curriculum. This would also allow students to use the Internet to analyze a DNA sequence using techniques different from what we would use in the lab. The students would have the opportunity to explore research tools used by biologists around the world. In order to perform this activity students should be competent in their computer abilities and should have a thorough understanding of how DNA contains information to create proteins. This activity is divided into three parts. The first part is exploration of the website. This will be done as a class with the teacher’s instructions to familiarize the students with the software. The students will be given two genes that they are supposed to sequence and answer questions on. Then they are given an opportunity to select their own gene to find and sequence. The second part requires the students to determine the origin of a particular DNA sequence provided. Here, the students will record information about the origin of the unknown gene and possible applications that it might have. Finally, as an independent exploration, each student will be asked to create a 100 to 150 base pair sequence of DNA. They will use the program to determine if this sequence exists in nature. If so, in what organism and if not, are there any closely related sequences. From this I hope the students will develop an appreciation for the amount of research that has been done and is continuing to be obtained. The students will be able to use a computer software program to determine the origin of a DNA sequence and to analyze an unknown or never before seen sequence. By the conclusion of this activity the students will have gained knowledge of the concepts presented. These concepts include DNA translation, DNA sequencing, DNA relationships, gene origins, and the use of technology to work in the fast growing field of biotechnology. </p><p>Background: </p><p>In order to understand this activity there are a few main concepts that a student needs to understand. Inside every organism there are cells. Some organisms contain many cells while others are only made up of one cell. Inside each cell there is DNA. DNA stands for deoxyribonucleic acid. It contains the information necessary to create a protein. The protein formed may stay in the cell or leave the cell. Either way it will have an effect on the organism. There are many steps that must be taken to move from DNA to a protein. This process begins with reading the DNA strand. DNA is like a book written with only four letters. All the chromosomes make up the book and the genes make up the words. The letters used to write the words are A, G, T, and C. A represents the nitrogenous base Adenine, G for Guanine, T for Thymine, and C for cytosine. These letters are written out in a long sequence. They may alternate or repeat. This sequence codes for a gene. In this activity the DNA sequence itself will be analyzed. DNA is double stranded but we will only be using one strand at a time. This information on the DNA must make it to the protein form to have an effect on the organism. The process of taking the information stored in DNA and creating a protein is referred to as the Central Dogma of Molecular Biology. This begins with RNA transcription. RNA transcription requires the making of an RNA strand from the DNA strand. RNA stands for ribose nucleic acid. It is similar in structure to DNA but it is single stranded, use ribose instead of deoxyribose, and uses uracil instead of thymine. The RNA polymerase, molecule responsible for the production of RNA, will bind to a promoter site just in front of a gene on the DNA. It will read the DNA and create a mRNA strand using base pairing. An A on the DNA will code for a U on the RNA. A T on the DNA will code for an A on the RNA. A G on the DNA will code for a C on the RNA and a C on the DNA will code for a G on the RNA. Now that a mRNA strand has been made it can carry the information stored in the DNA out to the cytoplasm to create the required protein. Before it can leave the nucleus, though, it has to be modified. The introns will be removed and the cap and tail will be added to ensure the protection of the mRNA and the production of the correct protein. Transcription is now complete. When the mRNA moves out to the cytoplasm it is ready for translation. A ribosome, which is an organelle found in the cytoplasm of a cell and is responsible for protein production will attach the mRNA. Here, tRNA will use base pairing to attach the correct amino acid. The mRNA will be read from the start codon through to the stop codon. It will always get read three letters at a time. This is referred to a translation. After the ribosome reaches the stop codon it will detach itself from the mRNA sequence and the amino acid chain. Depending on the order of amino acids the chain changes its shape to create a complete protein. This protein may stay in the cell or leave depending on where in the body it is needed. The proteins present determine many of the characteristics an organism will posses. It is important to understand that DNA codes for these proteins thereby determining the characteristics of an individual. In this activity it is important for the students to have background knowledge on how this process works. They need to understand what information is contained in DNA and why we need to be aware of it. The students should understand that research on DNA is ongoing. New discoveries are being made every day and some of them are being posted on this website. The students will have an opportunity to explore the products of some of this research. The students may ask how the actual DNA sequence was determined. This would be a good opportunity for the teacher to discuss DNA sequencing techniques. A lesson and lab on DNA sequencing could follow this lesson if the instructor so chooses but wouldn’t necessarily be required for this activity. </p><p>Exercises to be included:</p><p>To motivate the students about this activity I will ask them to pretend to be a molecular biologist for a day. I will ask them to pretend they are working in a new and very expensive lab. They have been given the task of determining the affects on the body that manipulation of a particular gene would have. They have been given a sequence of unknown DNA and they must determine the gene that it codes for and what organism it is from. I will tell the students that they are on a deadline and have only two days to determine the origin of the sequence. At first the students will think that this is impossible because of how long lab work can take. Then I will tell them about an online database that is used by scientists worldwide. Anytime a new discovery is made about a gene it is posted on the site. The students will use this site to determine the source of their DNA sequence before their deadline is up. This activity will be good learning opportunity for the kids. They will use their preexisting knowledge of molecular biology and technology skills to meet their imaginary deadline. The instructional materials needed include the worksheet and key attached to the sheet along with access to computers and Internet service. There should be enough computers so that each student can work on their own. The computer lab in the building will work out just fine. </p><p>Special needs adjustment:</p><p>To accommodate students with special needs I would allow those students to work in pairs. In my building there are computers in the special education room that some students prefer to work on. I would allow those students to take their assignments there to work. I would also allow them to have an extended deadline. I would make extra time in my schedule, during prep hour for example, to walk these students through the software. If a student has a physical impairment that prevents them from working on a computer they could work with a partner or myself and tell me where to click and why. </p><p>References:</p><p>The idea for this project came for an online course titled, “Bioinformatics for Teachers” taught by Karen Klyczek of University of Wisconsin – River Falls during the summer 2007 for the completion of a Masters in Science Education Program. The website used was the National Institutes of Health homepage located at http://www.ncbi.nlm.nih.gov. The date online was June, 2007. The instructions, worksheet and key required accompany this project. No additional references are required. </p><p>Evaluation and assessment method:</p><p>An informal and formal evaluation will be used to assess student learning. The informal assessment will be taken by the teacher in the computer lab. It will be based on the students’ ability to navigate the website and by participation and feedback. A formal assessment will be based on the completion of the worksheet provided. The key provided will be used to score the worksheet. This is a form of written assessment. There will not a quiz or test based solely on this activity but a question referring to the database could be used on the unit test. Alignment with standards:</p><p>This activity requires the integration of technology and biology. It also connects the topics of DNA, cellular biology, and genetics. The national standards met include Content Standard C [9-12] Molecular Basis of Heredity and Content Standard E [9-12] Understanding about Science and Technology. The Wisconsin state standards met include F 12-1, understanding cell structures and function, F 12-2, understanding cell differentiation and how cells are regulated, F 12-3, understanding information about molecular and genetic basis of heredity, F 12-4, relationship between function of cell and function of organism relates to genetics and heredity, G 12-4, show how a scientific or technological change can impact work. Name ______Date ______</p><p>DNA Analysis</p><p>Cell and molecular biologists are advancing their field of study through new discoveries everyday. How do biologists in the United States share information with biologists in Germany or Japan? The Internet provides a way of sharing information between scientists around the world. In this assignment you will be using the same website that scientists working in laboratories around the world use. </p><p>Part I. Familiarization with the website</p><p>Go to the National Center for Biotechnology Information website managed by the National Institutes of Health at http://www.ncbi.nlm.nih.gov to answer the following questions.</p><p>1. What information does this site contain?</p><p>2. A gene from Bacillus thuringiensis can be transferred into corn to provide protection from insects. The corn that contains the bacteria’s gene is called Bt corn. What is the sequence for this gene?</p><p>3. What other information were you given in addition to the nucleotide sequence?</p><p>4. Use the NCBI web site to obtain the complete coding sequence of the bovine prolactin receptor gene. Select “AF027403.” Paste the FASTA version of the sequence here. 5. Pick another organism, maybe Homo sapien, and select a gene to sequence. Print out the nucleotide sequence along with the name of the gene and the organism it comes from.</p><p>6. Who submitted this sequence and when?</p><p>7. What is the amino acid sequence for this gene?</p><p>Part II. Determining Origin of a Sequence</p><p>8. Use BLAST to determine what the sequence below is. What other, similar sequences were identified?</p><p>AGGATCCCAAGGCCCAACTCCCCGAACCACTCAGGGTCCTGTGGACAGCT CACCTAGCTGCAATGGCTACAGGCTCCCGGACGTCCCTGCTCCTGGCTTTT GGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAACCATT CCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGCAC CAGCTGGCCTTTGACACCTACCAGGAGTTTAGGCTGGAAGATGGCAGCCCC CGGACTGGGCAGATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCA CACAACGATGACGCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGG AAGGACATGGACAAGGTCGAGACATTCCTGCGCATCGTGCAGTGCCGCTCT GTGGAGGGCAGCTGTGGCTTCTAGCTGCCCGGGTGGCATCCCTGTGACCC CTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAG CCTTGTCCTAATAAAATTAAGTTGCATCA</p><p>* Hint: From the NCBI homepage click on BLAST, click on nucleotide blast, enter the above sequence in the space provided (be careful!), under “choose search set” click on “others” and nucleotide collection, under program choose Megablast, then click on BLAST</p><p>Many laboratories compete with one another to be the first sequence a piece of DNA. Pretend that you are a molecular biologist working for a well-known University. You are asked by your supervisor to analyze a gene. The lab has a lot of money invested into their biotechnology sector so you have access to the most modern tools. You are to determine the origin of a special sequence of DNA and if you can do this before anyone else you will get a big raise! Your lab has been given a two day deadline. Here is your DNA sequence:</p><p>ATCTTTTTTACCATCGAGTATAATAATTTTCTTTATAATAGGTAAACGTGATTG TACTCCTAGAATTTTCTGCAATGAGTTTCTAGATGTAAATACTACAGTTGGCT GTGAGATACTCAAGCTGTTATACAATTCACGTTCGTTATAAATATCGTTAGTT ACCGTCACAGAAGTAAACTAGTAAAGCCACCATGTCAATAGAGAATAACATT TTGATAGGACCACCTCCGTACTATCCTTTGGAAGAAGGTACTGCGGGAGAA CAATTACACAGAGCCATATCACGATATGCCGCAGTTCCAGGAACACTAGCTT ATACAGATGTACACACCGAACTTGAAGTTACTTATAAGGAGTTTTTAGATGTA ACATGTCGCTTAGCTGAAGCTATGAAGAACTATGGCTTAGGCTTACAGCATA CTATTTCTGTATGTAGTGAAAACTGCGTACAATTCTTTATGCCAATTTGCGCT GCTTTATATGTTGGGGTTGCAACCGCGCCTACAAACGATATTTATAACGAAC GTGAATTGTATAACAGCTTGAGTATCTCACAGCCAACTGTAGTATTTACATCT AGAAACTCATTGCAGAAAATTCTAGGAGTACAATCACGTTTACCTATTATAAA GAAAATTATTATACTCGATGGTAAAAAAGATTACTTGGGGTATCAATCTATGC AGTCCTTCATGAAAGAACACGTTCCTGCCAATTTCAATGTATCAGCATTTAAA CCACTTTCATTTGATCTTGACCGAGTTGCATGTATTATGAACTCTTCAGGTTC TACGGGATTACCAAAAGGTGTACCAATATCGCACAGAAACACCATATACAGG TTTTCCCATTGCAGAGATCCAGTATTTGGCAATCAAATTATTCCGGATACAAC TATACTATGTGCTGTTCCATTCCATCATGCGTTTGGCACTTTCACAAATTTAG ATATTTAATATGTGGCTTCCACGTAGTGCTTATGTACAGATTCAATGAACATT TATTCTTACAAACACTACAAGATTACAAATGTCAAAGCGCGTTACTAGTACCT ACAGTACTTGCGTTTCTTGCTAAAAACCCTTTGGTTGATAAATATGATTTATC AAATTTACATGAAATTGCTTCTGGGGGTGCCCCACTTTCAAAAGAAATTTCA GAAATAGCAGCAAAACGATTTAAACTACCAGGAATACGACAAGGGTATGGT CTAACTGAAACAACGTGTGCTATTGTAATTACTGCTGAAGGAGAATTTAAAC TTGGGGCTGTCGGAAAAGTTGTACCATTTTATTCCTTAAAAGTTCTTGATCTT AATACAGGAAAAAAATTGGGGCCAAACGAGAGGGGGGAAATATGTTTCAAA GGACCTATGATTATGAAAGGTTATATAAATAATCCAGAAGCAACACGCGAGT TAATTGATGAAGAGGGATGGATACACTCTGGTGATATAGGATATTTTGATGA AGATGGCCATGTATACATTGTTGATCGATTGAAATCTTTGATTAAATACAAAG GCTATCAAGTTCCGCCCGCCGAGTTAGAAGCTTTACTGCTGCAGCATCCGT TTATTGAAGATGCAGGAGTTGCGGGTGTTCCCGATGAAGTTGCGGGTGATC TTCCTGGTGCTGTTGTAGTTTTAAAAGAAGGAAAATCTATTACAGAAAAAGAA ATCCAAGATTACGTGGCAGGCCAAGTAACTTCTTCGAAAAAGTTACGAGGA GTGTTGAATTTGTGAAAGAGGTACCCAAAGGTTTTACTGGAAAAATTGATAC CAGAAAAATAAAAGAAATACTTATTAAGGCACAAAAAGGCAAATCCAAATCC AAAGCCAAATTGTAAACTAAGTGTTTGTTAATGTTGTTAAACATTTTATAAAAT ACACTGTAGCTATTTATTAGTAACCAAAATGCTTCTAACATCAAGATGCCTAT ATCTAAGAACGTTGTATTTATATACTTTGGGGTTTTTGGTGATTATGTCAAAT GTATGTGTGAAAAGGGTATACGTAGTTTAAGGGACATAAAAATAAATAAAATT AATTATTGGATTTGG</p><p>9. What organisms is it from? 10. What gene does it code for?</p><p>11. What could happen if you were to extract this gene and place it into another organism?</p><p>Part III. Invention</p><p>Create your own nucleotide sequence between 100 – 150 base pairs. Run it through the BLAST program and see if how close you came to an actual gene. Include a print out of your gene sequence. Indicate the 5’ and 3’ end.</p><p>12. Were you close to a gene sequence of a studied organism? If so, which one and how close? Name __Key_40 Points______Date ______</p><p>DNA Analysis</p><p>Cell and molecular biologists are advancing their field of study through new discoveries everyday. How do biologists in the United States share information with biologists in Germany or Japan? The Internet provides a way of sharing information between scientists around the world. In this assignment you will be using the same website that scientists working in laboratories around the world use. </p><p>Part I. Familiarization with the website Go to the National Center for Biotechnology Information website managed by the National Institutes of Health at http://www.ncbi.nlm.nih.gov to answer the following questions.</p><p>1. What information does this site contain? (2 points)</p><p>This site contains information about research articles, journals, links to other related sites, database to human genetics (OMIM), ect.</p><p>2. A gene from Bacillus thuringiensis can be transferred into corn to provide protection from insects. The corn that contains the bacteria’s gene is called Bt corn. What is the sequence for this gene? (5 points)</p><p>Instruct the students to search the “nucleotide” database, then type in Bacillus thuringiensis. Click go. Now add “crystal toxin” after the bacteria to refine the search. Select a sequence this is a complete cds (coding sequence). Select “EF094885.” To display it without the numbers and spaces select FASTA from the pull down menu next to the display button. Copy and paste here. </p><p>ATGAATAGTGTATTGAATAGCGGAAGAACTACTATTTGTGATGCGTATAATG TAGCGGCTCATGATCCATTTAGTTTTCAACACAAATCATTAGATACCGTACAA AAGGAATGGACGGAGTGGAAAAAAAATAATCATAGTTTATACCTAGATCCTA TTGTTGGAACTGTGGCTAGTTTTCTGTTAAAGAAAGTGGGGAGTCTTGTTGG AAAAAGGATACTAAGTGAGTTACGGAATTTAATATTTCCTAGTGGTAGTACAA ATCTAATGCAAGATATTTTAAGAGAGACAGAAAAATTCCTGAATCAAAGACTT AATACAGACACTCTTGCCCGTGTAAATGCGGAATTGACAGGGCTGCAAGCA AATGTAGAAGAGTTTAATCGACAAGTAGATAATTTTTTGAACCCTAACCGAAA CGCTGTTCCTTTATCAATAACTTCTTCAGTTAATACAATGCAACAATTATTTCT AAATAGATTACCCCAGTTCCAGATGCAAGGATACCAACTGTTATTATTACCTT TATTTGCACAGGCAGCCAATTTACATCTTTCTTTTAAACACTCGTTTACACGA TATGTTAGAATTTAGAACATATATGTTTTTAAATGTATTTGAGTATGTATCTAT CTGGTCGTTGTTTAAATATCAAAGTCTTATAGTATCTTCCGGCGCTAATTTAT ATGCTAGCGGTAGTGGACCACAGCAGACCCAATCATTTACAGCACAAAACT GGCCATTTTTATATTCTCTTTTCCAAGTTAATTCGAATTATATATTATCTGGTA TTAGTGGTACTAGGCTTTCTATTACCTTCCCTAATATTGGTGGTTTACCGGG TAGTACTACAACTCATTCATTGAATAGTGCCAGGGTTAATTATAGCGGAGGA GTTTCATCTGGTCTCATAGGGGCGACTAATCTCAATCACAACTTTAATTGCA GCACGGTCCTCCCTCCTTTATCAACACCATTTGTTAGAAGTTGGCTGGATTC AGGTACAGATCGAGAGGGCGTTGCTACCTCTACGAATTGGCAGACAGAATC CTTTCAAACAACTTTAAGTTTAAGGTGTGGTGCTTTTTCAGCCCGTGGAAATT CAAACTATTTCCCAGATTATTTTATCCGTAATATTTCTGGGGTTCCTTTAGTT ATTAGAAACGAAGATCTAACAAGACCGTTACACTATAACCAAATAAGAAATAT AGAAAGTCCTTCGGGAACACCTGGTGGAGCACGGGCCTATTTGGTATCTGT GCATAACAGAAAAAATAATATCTATGCCGCTAATGAAAATGGTACTATGATC CATTTGGCGCCAGAAGATTATACAGGATTTACTATATCGCCAATACATGCCA CTCAAGTGAATAATCAAACTCGAACATTTATTTCTGAAAAATTTGGAAATCAA GGTGATTCCTTAAGATTTGAACAAAGCAACACGACAGCTCGTTATACGCTTA GAGGGAATGGAAATAGTTACAATCTTTATTTAAGAGTATCTTCAATAGGAAAT TCAACTATTCGAGTTACTATAAACGGTAGAGTTTATACTGTTTCAAATGTTAA TACCACTACAAATAACGATGGAGTTAATGATAATGGAGCTCGTTTTTCAGAT ATTAATATCGGTAATATAGTAGCAAGTGATAATACTAATGTAACGCTAGATAT AAATGTGACATTAAACTCCGGTACTCCATTTGATCTCATGAATATTATGTTTG TGCCAACTAATCTTCCACCACTTTATTAA</p><p>3. What other information were you given in addition to the nucleotide sequence? (5 points) Locus – size of sequence and date submitted Definition – description of sequence Accession – number given to sequence Source – taxonomic description Reference – who submitted it Feature – biological properties of sequence Translation – amino acid sequence Origin – DNA nucleotide sequence </p><p>4. Use the NCBI web site to obtain the complete coding sequence of the bovine prolactin receptor gene. Select “AF027403.” Paste the FASTA version here. (5 points)</p><p>CGGGCAAATGCTGAGGATACTTTCCAAGTGAACCCTGAGTGAACCTCTAAT ATATTTATTTCCTGTGGAAAGAGGAAGGAGCCAACATGAAGGAAAATGCAG CATCTAGAGTGGTTTTCATTTTGCTACTTTTTCTCAGTGTCAGCCTTCTGAAT GGACAGTCACCTCCTGAAAAACCCAAGCTCGTTAAATGTCGGTCTCCTGGA AAGGAAACATTCACCTGCTGGTGGGAGCCTGGGGCAGATGGAGGACTTCC TACCAATTACACGCTGACTTACCACAAGGAAGGAGAAACACTCATCCATGAA TGTCCAGACTACAAAACCGGGGGCCCCAACTCCTGCTACTTTAGCAAGAAG CACACCTCCATATGGAAGATGTACGTCATCACAGTAAACGCCATCAACCAGA TGGGAATCAGTTCCTCGGATCCACTTTATGTGCACGTGACTTACATAGTTGA ACCAGAGCCTCCTGCAAACCTGACTTTGGAATTAAAACATCCAGAAGATAGA AAACCATATCTATGGATAAAATGGTCTCCACCCACCATGACTGATGTAAAAT CTGGTTGGTTCATTATCCAGTACGAAATTCGATTAAAACCTGAGAAAGCAAC TGATTGGGAGACTCATTTTACTCTGAAGCAAACTCAGCTTAAGATTTTCAACT TATATCCAGGACAAAAATACCTTGTGCAGATTCGCTGCAAGCCAGACCATG GATACTGGAGTGAGTGGAGCCCAGAGAGCTCCATCCAGATACCTAATGACT TCCCAGTGAAGGACACAAGCATGTGGATCTTTGTGGCCATCCTTTCTGCTGT CATCTGTTTGATTATGGTCTGGGCAGTGGCTTTGAAGGGCTATAGCATGGTA CCTGCATCCTCCCACCAGTTCCAGGGCCAAAAATAAAAGGATTTGATGTTCA TCTGCTGGAGATATCACAGCCTTCTCGCCTTGTGTCTATGTTTTAATAGGAG GGCAAGTCCGAAGAACTTCTGCGAGCTCTGGAAAGCCAAGACTTCCCCCCC ACTTCTGACTGCGAGGACTTGCTGATGGAGTTCATAGAGGTAGATGACTGT AGGACCAGCAGCTGATGCCACGCCCCTCCAAAGAACACACGGAGCAAGGC GTGAAGCCCATGCACCTGGATCTTGACAGTGACTCTGGCCGGGGCAGCTG CGACAGCCCTTCGCTCTTGTCTGAAAAGTGTGATGAACCTCAGGCCCATCC CTCCAAGTTCCATACTCCCGAGGGCCCTGAGAAGCTGGAGAATCCGGAAAC AAACCTTACATGTCTCCAGGCCCCTCAGAGCACAAGCGGGGAAGGCAAAAT CCCCTATTTTCTGGCCAATGGACCCAAATCTTCCACATGGCCTTTCCCGCAG CCCCCCAGCCTATACAGCCCCAGATATTCTTACCACAACATTGCTGACGTGT GTGAGCTGGCCCTGGGCATGGCCGGCACCACAGCCACTTCGCTGGACCAA ACAGACCAACATGCTTTAAAAGCCTCAAAAACCATTGAAACTGGCAGGGAA GAAAGGCAACCAAGCAGAGGGAGTCAGAAGGCTGCAGTTCCAAGCCTGAC CAAGACACGGTGTGGCCACGACCCCAAGACAAAACCCCCTTGATCTCTGCT AAACCCTTGGAATACGTGGAGATCCACAAGGTCAGCCAAGATGGAGTGCTG GCTCTGTTCCCAAAACAAAACGAGAAGTTTGGCGCCCCTGAAGCCAGCAAG GAGTACTCAAAGGTGTCCCGGGTGACAGATAGCAACATCCTGGTATTGGTG CCGGATCCGCAAGCGCAAAACCTGACTCTGTTAGAAGAACCAGCCAAGAAG GCCCCGCCAGCCCTGCCATAGAATCCAGCCAAGGCCGACCTGGCTATCTC CCCCACAACCCCAGGCAACTGCAGACTCCAGTTGGGCTGGGGACTGGGTC CCGCAGGTTTTATGCACTCTTGCAGTGAGAGTTATGGAAGGATGGGTTCAA TTGTGATTTTCCTTCAGGGAACACTACAGAGTACGTGAAATGCACTCTACCA GAGAGGGCTCAAGAACAGGGTTAGAATGACACTACCCAACTCCCAGTTCAC TCTTAATTCTCTATTTTCAACCAGTTGCCTCTTTGTCCAACAGCTGATTCCAG AACAAATCGTTCCATCTTGTGTGATTTGTAGATTTACTTTTTTGCTATTAGTTG TCAGATTATATGTTCAAAGATATAAAAGCACATTGCCTAGTATTCTTAAGAGA CAGTGCCAATAGGTATATAATCTGGAAAAGGCCTTCATGGTTTCGTATGTGA CAGAGGGGTATAAGTCAGTCAAAATTGTTTACCATGGGAAGATGGTAGATA GGAGAGAAATGCCATGAAAACCACTTTGAAGACCAGTTGCTTAACCTTTGCA CTCCTCTTT</p><p>5. Pick another organism, maybe Homo sapien, and select a gene to sequence. Print out the nucleotide sequence along with the name of the gene and the organism it comes from. (2 points)</p><p>Answers may vary.</p><p>6. Who submitted this sequence and when? (2 points)</p><p>Answers may vary.</p><p>7. What is the amino acid sequence for this gene? (2 points)</p><p>Answers may vary.</p><p>Part II. Determining Origin of a Sequence</p><p>8. Use BLAST to determine what the sequence below is. What other, similar sequences were identified? (5 points) </p><p>AGGATCCCAAGGCCCAACTCCCCGAACCACTCAGGGTCCTGTGGACAGCT CACCTAGCTGCAATGGCTACAGGCTCCCGGACGTCCCTGCTCCTGGCTTTT GGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAACCATT CCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGCAC CAGCTGGCCTTTGACACCTACCAGGAGTTTAGGCTGGAAGATGGCAGCCCC CGGACTGGGCAGATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCA CACAACGATGACGCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGG AAGGACATGGACAAGGTCGAGACATTCCTGCGCATCGTGCAGTGCCGCTCT GTGGAGGGCAGCTGTGGCTTCTAGCTGCCCGGGTGGCATCCCTGTGACCC CTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAG CCTTGTCCTAATAAAATTAAGTTGCATCA</p><p>* Hint: From the NCBI homepage click on BLAST, click on nucleotide blast, enter the above sequence in the space provided (be careful!), under “choose search set” click on “others” and nucleotide collection, under program choose Megablast, then click on BLAST</p><p>This is the nucleotide sequence for the human growth hormone 1 (GH1), transcript variant 4. It is similar to the sequence for the human chrionic somatomammtropin 1 and human chrionic somatomammtropin 2. These genes are associated with lactose production.</p><p>Many laboratories compete with one another to be the first sequence a piece of DNA. Pretend that you are a molecular biologist working for a well-known University. You are asked by your supervisor to analyze a gene. The lab has a lot of money invested into their biotechnology sector so you have access to the most modern tools. You are to determine the origin of a special sequence of DNA and if you can do this before anyone else you will get a big raise! Your lab has been given a two day deadline.</p><p>Here is your DNA sequence: ATCTTTTTTACCATCGAGTATAATAATTTTCTTTATAATAGGTAAACGTGATTG TACTCCTAGAATTTTCTGCAATGAGTTTCTAGATGTAAATACTACAGTTGGCT GTGAGATACTCAAGCTGTTATACAATTCACGTTCGTTATAAATATCGTTAGTT ACCGTCACAGAAGTAAACTAGTAAAGCCACCATGTCAATAGAGAATAACATT TTGATAGGACCACCTCCGTACTATCCTTTGGAAGAAGGTACTGCGGGAGAA CAATTACACAGAGCCATATCACGATATGCCGCAGTTCCAGGAACACTAGCTT ATACAGATGTACACACCGAACTTGAAGTTACTTATAAGGAGTTTTTAGATGTA ACATGTCGCTTAGCTGAAGCTATGAAGAACTATGGCTTAGGCTTACAGCATA CTATTTCTGTATGTAGTGAAAACTGCGTACAATTCTTTATGCCAATTTGCGCT GCTTTATATGTTGGGGTTGCAACCGCGCCTACAAACGATATTTATAACGAAC GTGAATTGTATAACAGCTTGAGTATCTCACAGCCAACTGTAGTATTTACATCT AGAAACTCATTGCAGAAAATTCTAGGAGTACAATCACGTTTACCTATTATAAA GAAAATTATTATACTCGATGGTAAAAAAGATTACTTGGGGTATCAATCTATGC AGTCCTTCATGAAAGAACACGTTCCTGCCAATTTCAATGTATCAGCATTTAAA CCACTTTCATTTGATCTTGACCGAGTTGCATGTATTATGAACTCTTCAGGTTC TACGGGATTACCAAAAGGTGTACCAATATCGCACAGAAACACCATATACAGG TTTTCCCATTGCAGAGATCCAGTATTTGGCAATCAAATTATTCCGGATACAAC TATACTATGTGCTGTTCCATTCCATCATGCGTTTGGCACTTTCACAAATTTAG GATATTTAATATGTGGCTTCCACGTAGTGCTTATGTACAGATTCAATGAACAT TTATTCTTACAAACACTACAAGATTACAAATGTCAAAGCGCGTTACTAG TACCTACAGTACTTGCGTTTCTTGCTAAAAACCCTTTGGTTGATAAATATGAT TTATCAAATTTACATGAAATTGCTTCTGGGGGTGCCCCACTTTCAAAAGAAAT TTCAGAAATAGCAGCAAAACGATTTAAACTACCAGGAATACGACAAGGGTAT GGTCTAACTGAAACAACGTGTGCTATTGTAATTACTGCTGAAGGAGAATTTA AACTTGGGGCTGTCGGAAAAGTTGTACCATTTTATTCCTTAAAAGTTCTTGAT CTTAATACAGGAAAAAAATTGGGGCCAAACGAGAGGGGGGAAATATGTTTC AAAGGACCTATGATTATGAAAGGTTATATAAATAATCCAGAAGCAACACGCG AGTTAATTGATGAAGAGGGATGGATACACTCTGGTGATATAGGATATTTTGA TGAAGATGGCCATGTATACATTGTTGATCGATTGAAATCTTTGATTAAATACA AAGGCTATCAAGTTCCGCCCGCCGAGTTAGAAGCTTTACTGCTGCAGCATC CGTTTATTGAAGATGCAGGAGTTGCGGGTGTTCCCGATGAAGTTGCGGGTG ATCTTCCTGGTGCTGTTGTAGTTTTAAAAGAAGGAAAATCTATTACAGAAAAA GAAATCCAAGATTACGTGGCAGGCCAAGTAACTTCTTCGAAAAAGTTACGAG GAGGTGTTGAATTTGTGAAAGAGGTACCCAAAGGTTTTACTGGAAAAATTGA TACCAGAAAAATAAAAGAAATACTTATTAAGGCACAAAAAGGCAAATCCAAAT CCAAAGCCAAATTGTAAACTAAGTGTTTGTTAATGTTGTTAAACATTTTATAA ATACACTGTAGCTATTTATTAGTAACCAAAATGCTTCTAACATCAAGATGCCT ATATCTAAGAACGTTGTATTTATATACTTTGGGGTTTTTGGTGATTATGTCAA ATGTATGTGTGAAAAGGGTATACGTAGTTTAAGGGACATAAAAATAAATAAA ATTAATTATTGGATTTGG 9. What organisms is it from? (2 points)</p><p>Photuris pennsylvanica (Pennsylania firefly)</p><p>10. What gene does it code for? (2 points)</p><p>Luciferase, the enzyme, protein, that makes the glow.</p><p>11. What could happen if you were to extract this gene and place it into another organism? (2 points)</p><p>You could make that other organism glow. Each cell that was expressing this gene would glow!</p><p>Part III. Invention</p><p>Create your own nucleotide sequence between 100 – 150 base pairs. Run it through the BLAST program and see if how close you came to an actual gene. Include a print out of your gene sequence. Indicate the 5’ and 3’ end.</p><p>12. Were you close to a gene sequence of a studied organism? If so, which one and how close? (6 points)</p><p>Answers may vary. </p>