<p> Kulkarni et al., 2017</p><p>Supplementary Information</p><p>To clone JEV-DIII, viral RNA was extracted using QIAamp® RNA Blood mini kit (Qiagen) from the brain homogenate of JEV infected mice.. Domain III was directly cloned from the viral genomic RNA with primers that contained restriction sites for BamHI and EcoRI. The primers used were: Forward Primer: 5’ –ATTACTGGATCCAGGACAAACTGGCTCTGAAG- 3’ and Reverse Primer: 5’ -ATTACTGAATTCCGTGCTTCCAGCTTTGTGCCAG- 3’. Amplification was carried out using a one step RT-PCR kit (Takara). The first step of the nested RT PCR was conducted using one step RT PCR Kit (Qiagen) and the second step using a regular PCR kit (Fermentas). Reverse transcription was performed at 50 °C for 30 mins followed by a PCR amplification which constituted of a hot start at 94°C for 5 mins followed by 45 cycles initial denaturation of 92°C of 1 min; annealing (55°C for 1 min) and extension (72°C for 1 min). This was followed by a final elongation at 72°C for 10mins. The amplified products were electrophoresed on 1.5% agarose gel stained with SyBr Safe (Life Technologies , USA) and the bands were visualized using a Gel Doc System (BioRad). The JEV-DIII fragment was purified from the agarose gel using the NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL), Cloning of JEV-DIII into pJET JEV-DIII was cloned into the cloning vector plasmids pJET (a bacterial cloning vector, Life Technologies,USA) by blunt end ligation process by T4 DNA ligase using manufacturer’s instructions. E.coli (DH5α) competent cells were then transformed using the heat shock method with the ligation mixture 10ul and ratio 1:5 and transformed cells were grown on Luria Bertoni plates containing ampicillin (50 μg/ml). Presence of JEV-DIII in colonies was verified both by restriction digestion and colony PCR (see below). The final recombinant plasmid was confirmed by DNA sequencing using T7 promoter and terminator primers. Cloning of JEV-DIII into pVAC. JEV-DIII was then cloned into pVAC (a mammalian expression vector, InvivoGen )[1] by digesting recombinant pJET containing JEV-DIII and the pVAC vector with EcoRI and BamHI New England Biolabs Inc., USA). pJET containing JEV-DIII (5 μg/μL) was digested and the vector pVAC (1 μg/μL) was linearized by incubating the plasmids with EcoRI and BamHI (5 used) at 37oC for 2 hrs. Restriction enzymes were inactivated by incubating the mixtures at 65°C for 10 mins. Mixtures were electrophoresed on a agarose gel and the JEV-DIII fragment from pJET and the linearized pVAC were isolated from the gel using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL), Digested JEV-DIII was ligated into the linearized pVAC by sticky end ligation process using T4 Ligase (Clonetech/ Takara) enzyme and incubated over night at 37 degrees. E.coli (DH5α) competent cells were then transformed using the heat shock method with the ligation mixture (10 μl ) and transformed cells were grown on the Fast-media Zeo agar(InvivoGen, USA) Plates were incubated at 37°C overnight and colonies were screened for presence of recombinant pVAC containing JEV-DIII using colony PCR. Colony PCR Single isolated colonies which grew on LB plates containing antibiotics were selected using sterile microtips and were directly used as the template in PCR reactions using 2X PCR master mix (Fermentas) PCR grade water and 0.8 μM of each primer which targeted the appropriate vector. Kulkarni et al., 2017</p><p>Forward Primer: 0.8 μM Primer pVAC 5’ TGTATAGGATGCAACTGCTG 3’ Reverse Primer: 0.8 μM Primer pVAC 5’ GAAACAAACAGTTCTGAGACCG 3’ Forward Primer: 0.8 μM Primer pJET 5’ CGACTCACTATAGGGAGAGCGGC 3’ Reverse Primer: 0.8 μM Primer pJET5’ AAGAACATCGATTTTCCATGGCAG 3’ PCR conditions were as described above. Kulkarni et al., 2017</p><p>Supplementary Figure 1</p><p>Supp Fig 1. A PCR of colonies after cloning JEV-DIII into the cloning vector pJET. Lane 1 shows the 100 bp marker and lane 3-7 shows the PCR products from individual colonies. Numbers on the LHS & RHS indicate DNA size in bps. B: Chromatogram and sequence of DIII cloned into the cloning vector pJET using the JEV- DIII forward primer. Arrow indicates the nucleotide bases which code for the amino acid circled below. C: Clustal W alignment of Domain III from SA-14-14-2 and GP78. Circle shows the amino acid difference between the two sequences. Kulkarni et al., 2017</p><p>Supplementary Figure 2</p><p>Supp Fig 2. Cloning of JEV-DIII into pVAC-1. (A) Vector map of the recombinant pVAC1 – JEV-DII. Shown are the site of insertion of JEV-DIII and their sizes. (B) Cloning JEV-DIII into the mammalian expression vector pVAC1. Lane 1- 6 shows the PCR products from individual colonies. Lane 7 shows the 100 bp marker. Numbers on the RHS indicate DNA size in bps. </p>