<p>Weigelt et al Supplementary Information 1</p><p>PIK3CA mutation, but not PTEN loss of function, determines the sensitivity of breast cancer cells to mTOR inhibitory drugs</p><p>Britta Weigelt, Patricia H. Warne and Julian Downward</p><p>SUPPLEMENTARY INFORMATION Weigelt et al Supplementary Information 2</p><p>Supplementary Table 1. Primers used for PCR amplification and sequencing.</p><p>PTEN (coding sequence; NM_000314) Exon Forward Primer Reverse Primer 1-4 CGTTAGCAGAAACAAAAGGAGA TTCAAAAGGATATTGTGCAACTC 5-7 ACCGCCAAATTTAATTGCAG AGGTTTCCTCTGGTCCTGGT 7-9 CGGAACTTGCAATCCTCAGT CTCTGGATCAGAGTCAGTGGTG</p><p>PIK3CA (coding sequence; NM_006218) Exon Forward Primer Reverse Primer 2, part 3 CACGACCATCATCAGGTGAA GAGGTCCCTAAGATCCACAGC 4-6 TCTTCACCAGAATTGCCAAA CCTGGGATTGGAACAAGGTA 7-10 CAATCCCAGGTGGAATGAAT TGGGTAGAATTTCGGGGATA 8-11 TTTGCCTTTCCATTTGCTCT GGCCAATCTTTTACCAAGCA 19-21 GCAGTTCAACAGCCACACAC TGTGTGGAAGATCCAATCCA Weigelt et al Supplementary Information 3</p><p>Supplementary Table 2. Breast cancer cell lines and growth media used in this study. Growth media and additives according to ATCC instructions, with the </p><p> exception that L-15 medium formulated for use in a CO2-free atmosphere was </p><p> replaced with DMEM in a 10% CO2 atmosphere. Media was supplemented with 100 μg/ml streptomycin and 100 U/ml penicillin.</p><p>ATCC Culture Cell Line Growth Media Number Conditions</p><p>1 AU565 CRL-2351 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>2 BT20 HTB-19 DMEM, 10% FBS 37°C, 10% CO2</p><p>3 BT474 HTB-20 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>4 BT483 HTB-121 RPMI-1640, 10% FBS, 0.01 mg/ml bovine insulin 37°C, 5% CO2</p><p>5 BT549 HTB-122 RPMI-1640, 10% FBS, 0.001 mg/ml bovine insulin 37°C, 5% CO2</p><p>6 CAMA1 HTB-21 DMEM, 10% FBS 37°C, 10% CO2</p><p>7 HCC1187 CRL-2322 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>8 HCC1395 CRL-2324 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>9 HCC1419 CRL-2326 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>10 HCC1428 CRL-2327 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>11 HCC1500 CRL-2329 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>12 HCC1569 CRL-2330 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>13 HCC1806 CRL-2335 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>14 HCC1937 CRL-2336 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>15 HCC1954 CRL-2338 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>16 HCC202 CRL-2316 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>17 HCC38 CRL-2314 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>18 HCC70 CRL-2315 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>19 HS578T HTB-126 DMEM, 10% FBS, 0.01 mg/ml bovine insulin 37°C, 10% CO2</p><p>20 MCF7 HTB-22 DMEM, 10% FBS, 0.01 mg/ml bovine insulin 37°C, 10% CO2</p><p>21 MDA-MB-157 HTB-24 DMEM, 10% FBS 37°C, 10% CO2</p><p>22 MDA-MB-231 HTB-26 DMEM, 10% FBS 37°C, 10% CO2</p><p>23 MDA-MB-361 HTB-27 DMEM, 20% FBS 37°C, 10% CO2</p><p>24 MDA-MB-415 HTB-128 DMEM, 15% FBS, 0.01 mg/ml insulin, 0.01 mg/ml glutathione 37°C, 10% CO2</p><p>25 MDA-MB-436 HTB-130 DMEM, 10% FBS, 0.01 mg/ml insulin, 0.016 mg/ml glutathione 37°C, 10% CO2</p><p>26 MDA-MB-453 HTB-131 DMEM, 10% FBS 37°C, 10% CO2</p><p>27 MDA-MB-468 HTB-132 DMEM, 10% FBS 37°C, 10% CO2</p><p>28 SKBR3 HTB-30 McCoy's 5A, 10% FBS 37°C, 5% CO2</p><p>29 T47D HTB-133 RPMI-1640, 10% FBS, 0.01 mg/ml bovine insulin 37°C, 5% CO2</p><p>30 ZR751 CRL-1500 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>31 ZR7530 CRL-1504 RPMI-1640, 10% FBS 37°C, 5% CO2</p><p>DMEM: Dulbecco’s modified Eagle’s medium; FBS: fetal bovine serum; RPMI: Roswell Park Memorial Institute medium. Weigelt et al Supplementary Information 4</p><p>Supplementary Figure 1. Effects of everolimus and PP242 on signal transduction pathways in breast cancer cells. (a) PIK3CA/PTEN wild-type mTOR inhibitor resistant, (b) PIK3CA mutant mTOR inhibitor sensitive and (c) PTEN null mTOR inhibitor resistant cells were treated for 3 h with indicated concentrations of everolimus (left) or PP242 (right) and whole cell lysates were analysed by Western blotting for total and activated levels of AKT, RPS6, 4E-BP1 and ERK1/2, and α- Tubulin as loading control. MDA: MDA-MB; mut: mutant; null: loss of function; wt: wild-type. Weigelt et al Supplementary Information 5</p><p>Supplementary Figure 2. Effects of everolimus and PP242 on signal transduction pathways in breast cancer cells. The outlier PTEN null mTOR inhibitor sensitive cell lines CAMA1 and ZR75-1, and the HER2-amplified PTEN null everolimus-resistant PP242-sensitive HCC1569 cells were treated for 3 h with indicated concentrations of everolimus (left) or PP242 (right) and whole cell lysates were analysed by Western blotting for total and activated levels of AKT, RPS6, 4E-BP1 and ERK1/2, and α- Tubulin as loading control. *HER2 amplification; mut: mutant; null: loss of function; wt: wild-type. Weigelt et al Supplementary Information 6</p><p>Supplementary Figure 3. Quantification of phospho- and total ERK1/2 expression levels in breast cancer cells. Whole cell lysates of (a) PIK3CA/PTEN wild-type, (b) PTEN null, (c) PIK3CA mutant, and (d) outlier breast cancer cells (PTEN null mTOR inhibitor sensitive CAMA1, ZR75-1 cells; PTEN mutant HER2-amplified everolimus resistant PP242 sensitive MDA-MB-453 cells) treated for 3 hours with 10 µM everolimus or 1 µM PP242 were resolved on Bis-Tris gels and proteins transferred onto Immobilon PVDF fluorescence membranes. Membranes were probed with antibodies against phospho- and total ERK1/2 simultaneously, incubated with IRDye 800CW Goat anti-Mouse IgG and IRDye 680LT Goat anti-Rabbit secondary antibodies, scanned using the Odyssey Infrared Imaging System and analysed and quantified using the 500 Odyssey Software. ERK1/2 activation levels, represented as ratio of phosphorylated ERK1/2Thr202/Tyr204 to total ERK1/2, are shown in Figure 4e. Ctrl: control; Evero: everolimus; MDA: MDA-MB; mut: mutant; null: loss of function; wt: wild-type; *: HER2 amplification. Weigelt et al Supplementary Information 7</p><p>Supplementary Figure 4. Effects of MEK inhibitors on ERK1/2 activation and of combined mTOR and MEK inhibition on ERK1/2 and AKT activation in breast cancer cells. (a) PIK3CA/PTEN wild-type MDA-MB-157 and PTEN null HCC38 mTOR inhibitor resistant cells were treated for 3 h with indicated concentrations of U0126 or AZD6244 and whole cell lysates were analysed by Western blotting for total and activated levels of ERK1/2 and α-Tubulin as loading control; (b) PIK3CA/PTEN wild- type (left) and PTEN null (right) mTOR inhibitor resistant cells were treated for 3 h simultaneously with indicated concentrations of everolimus or PP242 and U0126 or AZD6244 and analysed by Western blotting for total and activated levels of AKT, ERK1/2 and α-Tubulin as loading control. E: everolimus; null: loss of function; P: PP242; wt: wild-type. Weigelt et al Supplementary Information 8</p><p>Supplementary Figure 5. Response of mTOR inhibitor resistant breast cancer cell lines grown in 2D monolayers to combined mTOR and MEK inhibition. (a) PIK3CA/PTEN wild-type and (b) PTEN null breast cancer cells were treated with indicated concentrations of everolimus, PP242, U0126 or AZD6244 alone or in combination. The surviving fraction relative to untreated control cells was assessed 72 h after treatment using the CellTiter-Blue assay. AZD: AZD6244; null: loss of function; U0: U0126; wt: wild-type. Weigelt et al Supplementary Information 9</p><p>Supplementary Figure 6. Response of mTOR inhibitor resistant breast cancer cell lines grown in three-dimensional cell cultures to combined mTOR and MEK inhibition. (a) PIK3CA/PTEN wild-type and (b) PTEN null breast cancer cells were treated with indicated concentrations of everolimus, PP242, U0126 or AZD6244 alone or in combination. The surviving fraction relative to untreated controls cells was assessed 120 h after treatment using the CellTiter-Blue assay. AZD: AZD6244; null: loss of function; U0: U0126; wt: wild-type. Weigelt et al Supplementary Information 10</p><p>Supplementary Figure 7. Response of breast cell lines to everolimus and PP242 in three-dimensional cell cultures. Micrographs of (a-f) PIK3CA/PTEN wild-type HCC1806, (g-l) PIK3CA mutant MCF7 and (m-r) PTEN null HCC1937 cells cultured on top of Matrigel after 72 hours of treatment with 10 µM everolimus or 10 µM PP242. As observed in two-dimensional cell cultures, PIK3CA/PTEN wild-type and PTEN null cell lines were resistant, whilst PIK3CA mutant cells were sensitive to mTOR inhibitors. a-c, g-i, m-o: 4x magnification; d-f, j-l, p-r: 10x magnification. Mut: mutant; null: loss of function; wt: wild-type. Weigelt et al Supplementary Information 11</p><p>Supplementary Figure 8. Response of HER2-amplified cell lines and outliers to mTOR inhibitors is independent of the cell culture environment. HCC1419, CAMA1 and MDA-MB-361 cells were grown in two-dimensional (2D; grey) or three- dimensional (3D; black) cell culture models and treated with serial dilutions of the rapalogue everolimus (left) or the active-site inhibitor PP242 (right). Response was assessed 72 h after treatment relative to untreated cells using the CellTiter-Blue assay. The HER2-amplified PIK3CA/PTEN wild-type HCC1419 cells were sensitive to PP242, the outlier PTEN null CAMA1 cells were resistant to everolimus and PP242, and the outlier PIK3CA mutated MDA-MB-361 cells were resistant to everolimus in both 2D and 3D cell cultures. Error bars depict standard error of median. ECM: extracellular matrix; HER2-ampl: HER2-amplified; MDA: MDA-MB; mut: mutant; null: loss of function; wt: wild-type.</p>