Table S1 Primer Sequences of Porcine STAT4 and STAT6 Genes Used in This Study

Table S1 Primer Sequences of Porcine STAT4 and STAT6 Genes Used in This Study

<p> Table S1 primer sequences of porcine STAT4 and STAT6 genes used in this study Gene Primer name Primer sequence(5’-3’) Binding Tm(℃) Size(bp) name region STAT4 CDS-4F ACTTGAGCACTGCCTGGGACC 5’-UTR 62.2 2476 CDS-4R TTTTTAGCATTTCCGTCACAACA 3’-UTR STAT6 CDS-6F AGGGAGAAGACAGCAGAGGGG 5’-UTR 66.5 3890 CDS-6R ATGGGCAAGTGTCCAGAGCAG 3’-UTR STAT4 exp-4F GGTTGTCTGCTCTACCATTCGCT Exon21 66 221 exp-4R TCGGATTGTTGAGATGGGGA Exon22 STAT6 exp-6F CCCAGGTACTGAAGACGCAGAC Exon9 60 254 exp-6R CAGGTTCTTGAACAGGGCAGAG Exon10 Beta-actin ACTIN-F GGACTTCGAGCAGGAGATGG 62 233 ACTIN-R GCACCGTGTTGGCGTAGAGG STAT4 map-4F TTGTCTGCTCTACCATTCGCTG Exon21 60 348 map-4R TGAAGTCTGGTCACAGCTATGAA Intron21 STAT6 map-6F TTTGGTCTCTTCTGTCCACTCC Intron19 64 150 map-6R CACCCTTCACAATAATCCTCTG Intron19 STAT4 pEGFP-4F CCGCTCGAGAGCATGTCTCAGTGGAATCA 5’-UTR 60 2267 pEGFP-4R CCGGAATTCCTTCAGCAGAATAGGGAGACT 3’-UTR STAT6 pEGFP-6F GCGAGCGCTATCATGTCTCTGTGGGGTCT 5’-UTR 60 2566 pEGFP-6R CCGGAATTCGCCAACTGGGGTTAGCCCTTA 3’-UTR STAT6 SNP-6F AGGAGACACTGGGTAGGAGGAG 3’-UTR 62 276 SNP-6R GTCACACAGGCAAAATCAGAGAG 3’-UTR Table S2 The exon/intron organizations of porcine STAT4 gene exon Coding exon intron coords Length(bp) coords Length(bp) coords Length(bp) Unkown Unkown Unkown Unkown 1-129 129 2-129 128 130-1571 1442 1572-1716 145 1572-1716 145 1717-57298 55582 57299-57397 99 57299-57397 99 57398-59764 2367 59765-59857 93 59765-59857 93 59858-61015 1158 61016-61094 79 61016-61094 79 61095-63043 1949 63044-63129 86 63044-63129 86 63130-65142 2013 65143-65294 152 65143-65294 152 65295-6768 2374 67669-67827 159 67669-67827 159 67828-68527 700 68528-68620 93 68528-68620 93 68621-72109 3489 72110-72169 60 72110-72169 60 72170-72693 524 72694-72711 18 72694-72711 18 72712-72824 113 72825-72918 94 72825-72918 94 72919-75013 2095 75014-75058 45 75014-75058 45 75059-85815 10757 85816-85899 84 85816-85899 84 85900-87807 1908 87808-87906 99 87808-87906 99 87907-90316 2410 90317-90452 136 90317-90452 136 90453-92331 1879 92332-92381 50 92332-92381 50 92382-92626 245 92627-92721 95 92627-92721 95 92722-94323 1602 94324-94460 137 94324-94460 137 94461-94772 312 94773-94964 192 94773-94964 192 94965-96653 1689 96654-96720 67 96654-96720 67 96721-97849 1129 97850-97958 109 97850-97958 109 97959-98991 1033 98992-99274 283 98992-99018 27 Note: only can be sure from the exon containing start cordon to the last exon containing stop cordon. Table S3 The exon/intron organizations of porcine STAT6 gene exon Coding exon intron coords Length(bp) coords Length(bp) coords Length(bp) 1-248 248 249-3701 3453 3702-3838 137 3723-3838 116 3839-4252 414 4253-4391 139 4253-4391 139 4392-4691 300 4692-4775 84 4692-4775 84 4776-5631 856 5632-5770 139 5632-5770 139 5771-5895 125 5896-5948 53 5896-5948 53 5949-6121 173 6122-6270 149 6122-6270 149 6271-7069 799 7070-7201 132 7070-7201 132 7202-7315 114 7316-7504 189 7316-7504 189 7505-8115 611 8116-8203 88 8116-8203 88 8204-8320 117 8321-8443 123 8321-8443 123 84444-9036 593 9037-9129 93 9037-9129 93 9130-9434 305 9435-9641 207 9435-9641 207 9642-10828 1187 10829-10923 95 10829-10923 95 10924-11013 90 11014-11150 137 11014-11150 137 11151-11493 343 11494-11640 147 11494-11640 147 11641-11848 208 11849-11912 64 11849-11912 64 11913-12022 110 12023-12133 111 12023-12133 111 12134-12326 193 12327-12419 93 12327-12419 93 12420-13454 1035 13455-13520 66 13455-13520 66 13521-13625 105 13626-13754 129 13626-13754 129 13755-13842 88 13843-15213 1371 13843-14032 190</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    3 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us