<p>Supporting materials and methods</p><p>Drugs and compounds </p><p>The chemical structure of DC120 was showed in Fig.1A. DC120 was synthesized and initially dissolved in 100% DMSO to generate a 50mM stock solution and stored at </p><p>−20°C. U0126 and RAD001 were obtained from Selleck Chemical (Boston, U.S.A.), dissolved in 100% DMSO at high concentrations, and stored at -20°C. </p><p>Cyclophosphamide (CTX) was obtained from Jiangsu Hengrui (Lianyungang, China) and freshly prepared in normal saline (NS) prior to use. W7 was purchased from </p><p>Sigma-Aldrich (Samoa, U.S.A.) and dissolved in ddH2O to a 50mM stock solution. 3-</p><p>MA was purchased from Sigma-Aldrich and dissolved in PBS at 200mM stock solution. TG was purchased from Sigma-Aldrich and dissolved in 100%DMSO at </p><p>8mM stock solution. BAPTA-AM was purchased from Merck Millipore (Billerica, </p><p>U.S.A.) and dissolved in 100%DMSO at 10mM stock solution.</p><p>Antibodies and reagents</p><p>Primary antibodies of AKT1, phospho-AKT1 (Ser473), phospho-AKT1 (Thr308), </p><p>GSK3α/β, Caspase-3, poly (ADP-ribose) polymerase (PARP), ERK1/2 and phospho-</p><p>ERK1/2 (Thr202/Tyr204) and horseradish peroxidase–conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (California, U.S.A.). </p><p>Antibodies against FOXO3α, 4E-BP1, mTOR, P70S6K, PRAS40, phospho-FOXO3α </p><p>(Ser318/321), phospho-4E-BP1 (Thr37/46), phospho- mTOR (Ser2448), phospho-</p><p>P70S6K (Thr389), phospho-PRAS40 (Thr246) and phospho-GSK3β (Ser9), the AKT kinase assay kit and chemiluminescence reagents were obtained from Cell Signaling </p><p>Technology (Boston, U.S.A.). The Annexin V–FITC apoptosis detection kit was purchased from Calbiochem. The transferase-mediated FITC-12-dUTP nick-end labeling (TUNEL) Assay Kit was purchased from Roche. DMSO, DAPI and MTT were purchased from Sigma. Lipofectamine 2000 and Alexa Fluor–labeled anti- fluorescein antibodies were obtained from Invitrogen (NY, U.S.A.). Fluo-3/AM and </p><p>EGTA (0.5M solution) were purchased from Beyotime Institute of Biotechnology </p><p>(Jiangsu, China).</p><p>TUNEL assay</p><p>Frozen tumor sections were stained with 50µl TUNEL reaction mixture as recommended by the manufacturer (In Situ Cell Death Detection Kit, POD, Roche). </p><p>For the negative control, only 50µl labeling solution was added to each slide. The slides were incubated for 60min at 37°C in a humidified atmosphere in the dark, then counterstained with DAPI (1μg/ml) for 5min and mounted under glass coverslips. </p><p>Slides were observed using confocal microscopy with an excitation wavelength in the range of 450–500nm and detection in the range of 515–565nm (green). TUNEL- positive nuclei stained green, and all other nuclei stained blue.</p><p>Plasmid and siRNA</p><p>Adenoviral vector pMSCV-puro was purchased from Clontech Laboratories, Inc.</p><p>The HA-tagged AKT1 plasmid was constructed using standard cloning methods. </p><p>Restriction endonucleases were BglⅡ and Xhol. Upstream primer was AGA AGATC TACCATGGACTACAAGGACGACGATGACAAGATGAGCGACGTGGCTATTGT and downstream primer was ATACTCGAGTCAAGCGTAATCTGGAACATCGT </p><p>ATGGGTAGGCCGTGCCGCTGGCCGA.</p><p>The target sequence for AKT2-specific siRNA was CGUGGUGAAUACAUCAAG A </p><p>TT, The target sequence for AKT3-specific siRNA was GAGGAGAGAAUGAA UU </p><p>GUATT, CSNK1D-specific siRNA was GCACCUUGGAAUUGAACAATT, </p><p>DYRK1B-specific siRNA was CGGAGAUGAAGUACUAUAUTT, and ADCK3 </p><p>-specific siRNA was CGGGACAAGUUGGAAUACUTT.</p>