<p>Supporting information for</p><p>Contributory roles of two L-lactate dehydrogenases for L- lactic acid production in thermotolerant Bacillus coagulans</p><p>Lifan Suna,b†, Caili Zhanga†, Pengcheng Lvc, Yanping Wangb, Limin Wanga* , Bo Yua,* a CAS Key Laboratory of Microbial Physiological and Metabolic Engineering, </p><p>Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China b School of Food Engineering and Biological Technology, Tianjin University of </p><p>Science & Technology, Tianjin 300457, China c College of Life Science and Bioengineering, Beijing University of Technology, </p><p>Beijing 100124, China</p><p>† L.S. and C.Z. contributed equally to this study.</p><p>* Corresponding author.</p><p>Correspondence and requests for materials should be addressed to L. W. </p><p>([email protected]) or B. Y. ([email protected]) .</p><p>Phone/Fax: +86-10-6480 6132</p><p>1 Lifan Sun, E-mail: [email protected]</p><p>Caili Zhang, E-mail: [email protected]</p><p>Yanping Wang, E-mail: [email protected]</p><p>Pengcheng Lv, , E-mail: [email protected]</p><p>2 Table S1 Strains and plasmids used in this study.</p><p>Strain or plasmid Relevant features a Reference or source Strains B. coagulans strains DSM1 Wild type DSMZ, Germany DSM1ΔldhL1 ldhL1 null mutant This study DSM1ΔldhL1- ldhL1 Complementation of DSM1ΔldhL1 with This study ldhL1 DSM1ΔldhL2 ldhL2 null mutant This study DSM1ΔldhL1ΔldhL2 ldhL1and ldhL2 null mutant This study DSM1ΔldhL1ΔldhL2- Complementation of DSM1ΔldhL1ΔldhL2 This study ldhL1 with ldhL1 This study DSM1ΔldhL1ΔldhL2- Complementation of DSM1ΔldhL1ΔldhL2 ldhL2 with ldhL2</p><p>E. coli strains Host for protein expression Tiangen Co., China BL21(DE3) Host for gene cloning Tiangen Co., China DH5α</p><p>Plasmids r pET-28a Protein expression vector, Kan Merck Co., Germany pET-28a-ldhL1 N-terminal His-tagged ldhL1 in pET28a, Kanr This study pET-28a-ldhL2 N-terminal His-tagged ldhL2 in pET28a, Kanr This study pET-28a-ldhD N-terminal His-tagged ldhD in pET28a, Kanr This study pUC19 Cloning vector, Apr Tiangen Co., China pMH77 pSH71 replication containing temperature 25 sensitive vector, Cmr pNW33n E. coli-Bacillus shuttle vector, cloning vector, BGSC, USA Cmr pNW33n-ldhL1 ldhL1-restoration vector, pNW33n harboring This study ldhL1gene with its native promoter, Cmr pNW33n-ldhL2 ldhL2-restoration vector, pNW33n harboring This study ldhL2 gene with its native promoter, Cmr pMH77-ΔldhL1 ldhL1 gene deletion vector, Cmr This study pMH77-ΔldhL2 ldhL2 gene deletion vector, Cmr This study a Cmr chloramphenicol resistant, Kanr kanamycin resistant, Apr ampicillin resistant.</p><p>3 Table S2 Primers used in this study.</p><p>Primer Sequence 5′→ 3′a Primers used for gene expression in pET-28a DSM1ldhL1F CCGGAATTCATGAAAAAAGTCAATCGTATTGC DSM1ldhL1R CCGCTCGAGTTACAATATCGGTGCCATTGTTTC DSM1ldhL2F TTCCATATGATGAGAAAGACGAAATTGGTGGTTG DSM1ldhL2R CCGCTCGAGAGCCCGAATATACGATTTTCCGG DSM1ldhDF CGCGGATCCATGAGAAAAGTTGTTGCC DSM1ldhDR CCGCTCGAGTACTTTTATCTCCCACCTG</p><p>Primers used for gene deletion L1 up-For CCGGAATTCGCTCCTTTCATTTGGTCAGAAAAATG L1 up-Rev AGCCCGGCCGGCACAAATGCATATAATCTTCCTCCCCATC L1 down-For GATGGGGAGGAAGATTATATGCATTTGTGCCGGCCGGGC L1 down-rev CCGCTCGAGGATCAACCGGGTCAGTGCAGTC L1 For GGGGGGCTTTCTTTTCATCAATTTG L1 Rev TGATTGAAACGATTTTAAACGCGG L2 up-For CCGGAATTCTGAAGGAGGGATACATATTTG L2 up-Rev GCCCTTTTACACCTTTCAGGTGTTGTCTCCCCTCCTTGTTTTC L2 down-For AACAAGGAGGGGAGACAACACCTGAAAGGTGTAAAAGGGC L2 down-Rev CCGCTCGAGCGGAGCACTGACATCGCAATACGAT L2 For AAACCGTCAACCGGGTTGTATTCCAGG L2 Rev GATGATGATCATCAAAATAAACATCAAACCGGC</p><p>Primers used for gene complementation ldhL1-For CCCAAGCTTAGCCTCATCGCCGGTTTCCCTCGC ldhL1-Rev CGCGAGCTCTTACAATATCGGTGCCATTGTTTCT ldhL2-For CCCAAGCTTTGGGCGATGCCAATCTGGCTTTATG ldhL2-Rev CGAGCTCTCAAGCCCGAATATACGATTTTCCG a Restriction sites in the primer sequences are underlined.</p><p>4 5 Figure S1. HPLC analysis of fermentation products in Bacillus coagulans DSM1 wild-type strain and mutants. DSM1 at 24-h (a), DSM1ΔldhL1 at 0-h (b), DSM1ΔldhL1 at 24-h (c), DSM1ΔldhL2</p><p> at 24-h (d), DSM1△ldhL1△ldhL2 at 0 h (e), DSM1△ldhL1△ldhL2 at 24-h (f), DSM1△ldhL1△ldhL2-ldhL1 complementation at 24-h (g), DSM1△ldhL1△ldhL2- ldhL2 complementation at 0-h (h), DSM1△ldhL1△ldhL2-ldhL2 complementation at 24-h (i).</p><p>6</p>