<p>Supplementary figure legends</p><p>Supp. Fig. 1 Correlation between the methylation level of Alu and that of LINE1 in normal mucosae, background mucosae and ESCCs. There was no significant correlation between the methylation levels of Alu and those of LINE1 in the normal mucosae (a) (r = 0.043, p = 0.678) and the background mucosae (b) (r = 0.063, p = 0.559). In ESCCs (c), a significant positive correlation was observed (r = 0.502, p < 0.001). </p><p>Supp. Fig. 2 Methylation levels of HOXA9, NEFH, UCHL1 and MT1M in normal mucosae of healthy subjects (n = 95), background mucosae of cancer patients (n = 89) and ESCCs (n = 93) collected by endoscopic biopsy. Distribution of the methylation levels at a specific CpG site of HOXA9 (a), NEFH (b), UCHL1 (c) or MT1M (d) is shown, and a horizontal line represents the mean methylation level for each group. The methylation levels of all the four genes increased in a stepwise manner. Especially, HOXA9 and UCHL1 methylation levels were significantly higher in the background mucosae than in the normal mucosae. The data were obtained from our previous paper [9], and the cases analyzed in this study were selected based upon the availability of genomic DNA. </p><p>Supp. Fig. 3 Representative immunohistochemical staining of MAGE-C1 in surgical specimens. (a) Non-cancerous background mucosa (ES-59, methylation level = 99.8%), (b) ESCC with full methylation (ES-62, methylation level = 97.4%) and (c) ESCC with demethylation (ES-49, methylation level = 51.9%) are presented. A scale bar represents 100 μm. Neither the background specimen nor the specimen of ESCC with full methylation had staining. Heterogeneous staining, mainly cytoplasmic, was observed in the specimen of ESCC with demethylation. </p><p>-1- Supp. Table 1. Primers and conditions for bisulfite pyrosequencing Primers Length Anneal. Numbe 5' -> 3' (bp) Temp r of (˚C) PCR cycles ALU Forward GATTATTTGAGGTTAGGAGTT 51 52 34 Reverse AATTTCTCCATATTAATCAAACTAATC Sequence: GATTATTTGAGGTTAGGAGTT LINE1 Forward TTTTGAGTTAGGTGTGGGATATA 146 52 40 Reverse AAAATCAAAAAATTCCCTTTC Sequence: GGGTGGGAGTGAT Anneal. Temp: annealing temperature. </p><p>-2- Supp. Table 2. Primers and conditions for real-time MSP</p><p>Primers</p><p>Forward (5' -> 3') Reverse (5' -> 3') Length (bp) Anneal.</p><p>Temp (˚C) </p><p>NY-ESO-1 M AGGGGCGGGGTTGGTGAGAATCG TCAAAACGCCTACGCACAAA 94 66</p><p>U GATAGGGGTTTGGTGGATAGTTG CACCCCTCCCCAAAAAAACCCA 95 67</p><p>MAGE-C1 M AGAGGAGGTTTCGTTTTACGTTATTC AACTCCCAAAATAACCGCCG 109 66</p><p>U AGGAGGTTTTGTTTTATGTTATTT CCACCAAAAAAACACATCCA 93 63 Anneal. Temp: annealing temperature. </p><p>-3-</p>