Comparison of Non-Canonical Pams for CRISPR/Cas9-Mediated DNA Cleavage in Human Cells

Comparison of Non-Canonical Pams for CRISPR/Cas9-Mediated DNA Cleavage in Human Cells

<p>Comparison of non-canonical PAMs for CRISPR/Cas9-mediated DNA cleavage in human cells</p><p>Yilan Zhang 1&, Xianglian Ge1&, Fayu Yang1, Liping Zhang1, Jiayong Zheng2, Xuefang Tan3, Zi-Bing Jin1, Jia Qu1, and Feng Gu1* 1School of Ophthalmology and Optometry, Eye Hospital, Wenzhou Medical University, State Key Laboratory Cultivation Base and Key Laboratory of Vision Science, Ministry of Health and Zhejiang Provincial Key Laboratory of Ophthalmology and Optometry, Wenzhou, Zhejiang 325027 China 2Department of Gynecology and Obstetrics, People’s Hospital of Wenzhou, Wenzhou, Zhejiang 325000 China 3Center for Infection and Immunity, Guangzhou Institutes of Biomedicine and Health (GIBH), Chinese Academy of Sciences, Guangzhou, Guangdong 510530 China </p><p>*Correspondence to: Feng Gu, Center for Vision Research, Eye Hospital, Wenzhou Medical University, China; 270 Xueyuan West Road, Wenzhou, Zhejiang, China, 325027 Phone (Fax): +86-577-8806 7926; E-mail: [email protected] </p><p>&These two authors contributed equally to this paper</p><p>Table of Contents Supplementary methods Supplementary Figures Figure S1 Figure S2 Supplementary Tables Table S1 Table S2 Table S3 Supplementary methods</p><p>The detection of GFP gene copy number GFP gene copy number was measured by Q-PCR. Briefly, the genomic DNA was isolated from the cells with GFP gene (SC1) or without GFP (Parental 293 cells) by standard techniques. Three pairs of PCR primers for the amplification of the fragments of GFP, ACTB (Beta-ACTIN) and FRMD7 genes were designed with online program</p><p>(http://www.idtdna.com/primerquest/Home/Index), respectively. ACTB (NM_001101) and FRMD7 (NM_194277) were located at autosomal chromosome and X chromosome, respectively, there are two ACTB and three FRMD7 gene copies per cell (http://www.atcc.org/Products/All/CRL-1573.aspx#characteristics). Sequences of primers used in this study are shown in Table S3. For quantitative PCR, the PCRs were performed as 95°C for 10 minute, followed by 40 cycles of 95°C for 10 second and 60°C for 60 second. Q-PCR data was analyzed with StepOne software. The GFP relative copy number were normalized to ACTB or FRMD7 using the formula 2^-(CT GFP- CT ACTB)/2^-(CT FRMD7- CT ACTB) or 2^-(CT GFP- CT FRMD7)/2^-(CT ACTB-CT FRMD7). Data shown are obtained from biological triplicates. Figure S1. GFP gene copy number measured by Q-PCR The GFP relative copy number was normalized to ACTB or FRMD7, and the gene copy number ratios of GFP to ACTB and to FRMD7 are about 0.42, 0.34, respectively. The results indicated that there is one GFP gene per cell. Figure S2. Sequencing of GFP-negative colony from NGA PAM of CRISPR/Cas9 -mediated DNA cleavage The GFP negative colonies were picked individually from NGA PAM of CRISPR/Cas9 -mediated DNA cleavage and the whole GFP gene was sequencing. Compare to wild-type (WT), one colony (mutant) has an 11-bp deletion, including one nucleotide of PAM (A of TGA) and 10-nucleotide following sequence (A, B), which leads to frame-shift mutation of GFP gene. It further confirmed that mutation does generate from NGA PAM for CRISPR/Cas9 -mediated DNA cleavage at GFP locus. Target sequence is in blue and PAM in pink. Table S1. Target sequences. Target sites for CRISPR/Cas9 System with NGG PAMs. Target site ID Target sequence PAM Strand (5'-3') NGG-0 CAAGTTCAGCGTGTCCGGCG TGG - NGG-1 CAAGTTCAGCGTGTCCGGCG AGG + NGG-2 CGCGCCGAGGTGAAGTTCGA GGG + NGG-3 CAAGATCCGCCACAACATCG AGG +</p><p>Table S2. Target sequences . Target sites for testing PAM specificity in CRISPR/Cas9 system. Target site ID Target sequence PAM Strand (5'-3') PAM-1 AACGGCATCAAGGTGAACTT NAA + PAM-2 GCCGACAAGCAGAAGAACGG NAT + PAM-3 ACGGCATCAAGGTGAACTTC NAG + PAM-4 TCATGGCCGACAAGCAGAAG NAC + PAM-5 AACTACAACAGCCACAACGT NTA + PAM-6 AAGAACGGCATCAAGGTGAA NTT + PAM-7 AGCAGAAGAACGGCATCAAG NTG + PAM-8 AGAACGGCATCAAGGTGAAC NTC + PAM-9 GCAGAAGAACGGCATCAAGG NGA + PAM-10 AAGCAGAAGAACGGCATCAA NGT + PAM-11 TCAAGGTGAACTTCAAGATC NGC + PAM-12 AAGGTGAACTTCAAGATCCG NCA + PAM-13 CAACTACAACAGCCACAACG NCT + PAM-14 CTTCAAGATCCGCCACAACA NCG + PAM-15 CATCAAGGTGAACTTCAAGA NCC + PAM-16 ACAAGTTCAGCGTGTCCGGC NAG + PAM-17 CCCGCGCCGAGGTGAAGTTC NAG + PAM-18 TCAAGATCCGCCACAACATC NAG + PAM-19 TTCAGCGTGTCCGGCGAGGG NGA + PAM-20 ACCCGCGCCGAGGTGAAGTT NGA + PAM-21 AAGATCCGCCACAACATCGA NGA +</p><p>Table S3. Oligonucleotide sequences.</p><p>Sequencing primers for plasmid construction and GFP mutation. </p><p>Primer name Primer sequence(5’-3’) U6-F GAGGGCCTATTTCCCATGATTC GFP-seq F GCTTGGCACTTGATGTAATTCTC GFP-seq R CATGCGGATCCTTCGAACT Oligonucleotide sequences for sgRNA architecture Primer name Primer sequence(5’-3’) NGG-0-F AAACCAAGTTCAGCGTGTCCGGCGC NGG-0-R CACCGCGCCGGACACGCTGAACTTG NGG-1-F CACCGCAAGTTCAGCGTGTCCGGCG NGG-1-R AAACCGCCGGACACGCTGAACTTGC NGG-2-F CACCGCGCGCCGAGGTGAAGTTCGA NGG-2-R AAACTCGAACTTCACCTCGGCGCGC NGG-3-F CACCGCAAGATCCGCCACAACATCG NGG-3-F AAACCGATGTTGTGGCGGATCTTGC PAM-1-F CACCGAACGGCATCAAGGTGAACTT PAM-1-R AAACAAGTTCACCTTGATGCCGTTC PAM-2-F CACCGGCCGACAAGCAGAAGAACGG PAM-2-R AAACCCGTTCTTCTGCTTGTCGGCC PAM-3-F CACCGACGGCATCAAGGTGAACTTC PAM-3-R AAACGAAGTTCACCTTGATGCCGTC PAM-4-F CACCGTCATGGCCGACAAGCAGAAG PAM-4-R AAACCTTCTGCTTGTCGGCCATGAC PAM-5-F CACCGAACTACAACAGCCACAACGT PAM-5-R AAACACGTTGTGGCTGTTGTAGTTC PAM-6-F CACCGAAGAACGGCATCAAGGTGAA PAM-6-R AAACTTCACCTTGATGCCGTTCTTC PAM-7-F CACCGAGCAGAAGAACGGCATCAAG PAM-7-R AAACCTTGATGCCGTTCTTCTGCTC PAM-8-F CACCGAGAACGGCATCAAGGTGAAC PAM-8-R AAACGTTCACCTTGATGCCGTTCTC PAM-9-F CACCGGCAGAAGAACGGCATCAAGG PAM-9-R AAACCCTTGATGCCGTTCTTCTGCC PAM-10-F CACCGAAGCAGAAGAACGGCATCAA PAM-10-R AAACTTGATGCCGTTCTTCTGCTTC PAM-11-F CACCGTCAAGGTGAACTTCAAGATC PAM-11-R AAACGATCTTGAAGTTCACCTTGAC PAM-12-F CACCGAAGGTGAACTTCAAGATCCG PAM-12-R AAACCGGATCTTGAAGTTCACCTTC PAM-13-F CACCGCAACTACAACAGCCACAACG PAM-13-R AAACCGTTGTGGCTGTTGTAGTTGC PAM-14-F CACCGCTTCAAGATCCGCCACAACA PAM-14-R AAACTGTTGTGGCGGATCTTGAAGC PAM-15-F CACCGCATCAAGGTGAACTTCAAGA PAM-15-R AAACTCTTGAAGTTCACCTTGATGC PAM-16-F CACCGACAAGTTCAGCGTGTCCGGC PAM-16-R AAACGCCGGACACGCTGAACTTGTC PAM-17-F CACCGCCCGCGCCGAGGTGAAGTTC PAM-17-R AAACGAACTTCACCTCGGCGCGGGC PAM-18-F CACCGTCAAGATCCGCCACAACATC PAM-18-R AAACGATGTTGTGGCGGATCTTGAC PAM-19-F CACCGTTCAGCGTGTCCGGCGAGGG PAM-19-R AAACCCCTCGCCGGACACGCTGAAC PAM-20-F CACCGACCCGCGCCGAGGTGAAGTT PAM-20-R AAACAACTTCACCTCGGCGCGGGTC PAM-21-F CACCGAAGATCCGCCACAACATCGA PAM-21-R AAACTCGATGTTGTGGCGGATCTTC qPCR primers used to measure the copy number of GFP gene in 293-SC1 cells</p><p>Primer name Primer sequence(5’-3’) ACTB-F GTACAGGTCTTTGCGGATGT ACTB-R GCTAAGTCCTGCCCTCATTT FRMD7-F CAGGTCAGCAGGTTGGTATT FRMD7-R CTTGTCCTTTCCTCTGCTCTAAT GFP-F TCAAGATCCGCCACAACATC GFP-R GTGCTCAGGTAGTGGTTGTC</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    8 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us