Table S1. Primers Used for PCR Amplification

Table S1. Primers Used for PCR Amplification

<p> Gene Name Primers Expected product size (and references) wsp, outer membrane protein Wolbachia Wsp-81F TGG TCC AAT AAG TGA TGA AGA AAC 610 pb (Braig et al. 1998; Zhou et al. 1998) wsp, outer membrane protein Wolbachia Wsp-691R AAA AAT TAA ACG CTA CTC CA 610 pb (Braig et al. 1998; Zhou et al. 1998) EF1-α EF1-196F GAGCGTGAACGTGGTATTAC 697 pb (Cho et al. 1995) EF1-α EF1-893R GCTTCGTGATGCATTTCTAC 697 pb (Cho et al. 1995) 16S rRNA, Spiroplasma specific MGSO TGCACCATCTGTCACTCTGTTAACCTC 870 pb (Hurst et al. 1999; van Kuppeveld et al. 1994) 16S rRNA, Spiroplasma specific HALN1 GCTCAACCCCTAACCGCC 870 pb (Hurst et al. 1999; van Kuppeveld et al. 1994) 16S rRNA, Cardinium specific Card.F TACTGTAAGAATAAGCACCGGC 450 pb (Zchori-Fein & Perlman 2004) 16S rRNA, Cardinium specific Card.R GTGGATCACTTAACGCTTTCG 450 pb (Zchori-Fein & Perlman 2004) 16S rRNA, FlavoBacteria specific Flav.F ATTGTTAAAGTTCCGGCG 800 pb (Hurst et al. 1997) 16S rRNA, FlavoBacteria specific Flav.R CTGTTTCCAGCTTATTCGTAGTAC 800 pb (Hurst et al. 1997) 16S rRNA, Rickettsia specific Rick.F CGGCTTTCAAAACTACTAATCTA 450 pb (Williams et al. 1992) 16S rRNA, Rickettsia specific Rick.R GAAAGCATCTCTGCGATCCG 450 pb (Williams et al. 1992) 16S rRNA, Arsenophonus specific group 1 Ars16SF1 GGGTTGTAAAGTACTTTCAGTCGT 600 pb (Duron et al. 2008) 16S rRNA, Arsenophonus specific group 2 Ars16SF2 CCCTAAGCTTAACTTAGGA 800 pb (Duron et al. 2008) 16S rRNA, Arsenophonus specific Ars16SR12 GTAGCCCTRCTCGTAAGGGCC 600/800 pb (Duron et al. 2008) ftsZ, cell cycle gene Wolbachia FtsZ-For1 TTTGAAGGTGTGCGCCGTAT 455 pb (Holden et al. 1993) ftsZ, cell cycle gene Wolbachia FtsZ-Rev1 TCATCTACTTCTTCACGCAC 455 pb (Holden et al. 1993) 16S rRNA universal EuBacteria Eu-27F AGAGTTTGATCCTGGCTCA 900 pb (Rousset et al. 1992) 16S rRNA universal EuBacteria Eu-1002R CGCGTTGCATCGAATTAAA 900 pb (Rousset et al. 1992)</p><p>Table S1. Primers used for PCR amplification References</p><p>Braig, H. R., Zhou, W., Dobson, S. L. & O'Neill, S. L. 1998 Cloning and characterization of gene encoding the major surface protein of the bacterial endosymbiont Wolbachia pipientis. J. Bacteriol. 180, 2373-2378.</p><p>Cho, S., Mitchell, A., Regier, J. C., Mitter, C., Poole, R. W., Friedlander, T. P. & Zhao, S. 1995 A highly conserved nuclear gene for low-level phylogenetics: elongation factor-1 alpha recovers morphology-based tree for heliothine moths. Mol. Biol. Evol. 12, 650-656.</p><p>Holden, P. R., Brookfield, J. F. & Jones, P. 1993 Cloning and characterization of an ftsZ homologue from a bacterial symbiont of Drosophila melanogaster. Mol. Gen. Genet. 240, 213-220. (doi:10.1007/BF00277059)</p><p>Hurst, G. D. D., Hammarton, T. C., Bandi, C., Majerus, T. M. O., Bertrand, D. & Majerus, M. E. N. 1997 The diversity of inherited parasites of insects: the male-killing agent of the ladybird beetle Coleomegilla maculata is a member of the Flavobacteria. Genet. Res. 70, 1-6. (doi:10.1017/S0016672397002838)</p><p>Hurst, G. D., Graf von der Schulenburg, J. H., Majerus, T. M., Bertrand, D., Zakharov, I. A., Baungaard, J., Volkl, W., Stouthamer, R. & Majerus, M. E. 1999 Invasion of one insect species, Adalia bipunctata, by two different male-killing bacteria. Insect Mol. Biol. 8, 133-139. (doi:10.1046/j.1365-2583.1999.810133.x)</p><p>Rousset, F., Bouchon, D., Pintureau, B., Juchault, P. & Solignac, M. 1992 Wolbachia endosymbionts responsible for various alterations of sexuality in arthropods. Proc. R. Soc. Lond. B 250, 91-98. (doi:10.1098/rspb.1992.0135)</p><p> van Kuppeveld, F. J., Johansson, K. E., Galama, J. M., Kissing, J., Bolske, G., van der Logt, J. T. & Melchers, W. J. 1994 Detection of mycoplasma contamination in cell cultures by a mycoplasma group-specific PCR. Appl. Environ. Microbiol. 60, 149-152.</p><p>Williams, S. G., Sacci, J. B., Jr., Schriefer, M. E., Andersen, E. M., Fujioka, K. K., Sorvillo, F. J., Barr, A. R. & Azad, A. F. 1992 Typhus and typhuslike rickettsiae associated with opossums and their fleas in Los Angeles County, California. J. Clin. Microbiol. 30, 1758-1762.</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us