Interferon Regulatory Factor 9 Protects Against Hepatic Insulin Resistance and Steatosis

Interferon Regulatory Factor 9 Protects Against Hepatic Insulin Resistance and Steatosis

<p>Interferon Regulatory Factor 9 is an Essential Mediator of Heart Dysfunction and Cell Death Following Myocardial Ischemia/Reperfusion Injury</p><p>Yan Zhang1,2*; Xiaoxiong Liu1,2*; Zhi-Gang She3*; Ding-Sheng Jiang1,2; Nian Wan1,2; Hao Xia1,2; Xue-Hai Zhu4; Xiang Wei4; Xiao-Dong Zhang5; Hongliang Li1,2#</p><p>Running title: IRF9 promotes Myocardial I/R Injury</p><p>1Department of Cardiology, Renmin Hospital of Wuhan University, Wuhan 430060, China; 2Cardiovascular Research Institute of Wuhan University, Wuhan 430060, China; 3Sanford-Burnham Medical Research Institute, Cancer Center, La Jolla, CA; 4Department of Thoracic and Cardiovascular Surgery, Tongji Hospital, Tongji Medical Colleg e, Huazhong University of Science and Technology, Wuhan 430030, China; 5College of Life Sciences, Wuhan University, Wuhan 430072, China;</p><p>*Yan Zhang, Xiaoxiong Liu, and Zhi-Gang She are co-first authors</p><p>Correspondence to Hongliang Li, MD, PhD Professor and Director Department of Cardiology Renmin Hospital of Wuhan University Cardiovascular Research Institute, Wuhan University Jiefang Road 238, Wuhan 430060, PR China Tel/Fax: 86-27-88076990 E-mail: [email protected] Supplemental Figure</p><p>A</p><p>IRF9-/- Sirt1flox/flox/Myh6-Cre</p><p>IRF9+/-/Sirt1flox/+ IRF9+/-/Sirt1flox/+ /Myh6-Cre /Myh6-Cre</p><p>IRF9-/-/Sirt1flox/flox /Myh6-Cre</p><p>6-week-old</p><p>Tamoxifen (80 mg/kg/day) treatment for five consecutive days </p><p>IRF9-/-/Sirt1-HKO (DKO)</p><p>B WT Sirt1-KO</p><p>Sirt1 120kDa</p><p>GAPDH 37kDa</p><p>Supplemental Fig. (A) Breeding scheme for the production of IRF9-/-/Sirt1flox/flox/Myh6-Cre double knockout mice (DKO). (B) Representative western blots for determination of Sirt1 knockout. Supplemental Tables</p><p>Supplemental Table 1. Antibodies for immunoblot and immunofluorescence analyses.</p><p>Antibody Cat No. Manufacturer Sources of Dilution Species GAPDH MB001 Bioworld mouse 1/10000</p><p>IRF9 sc10793 Santa Cruz rabbit 1/200</p><p>Sirt1 sc15404 Santa Cruz rabbit 1/200</p><p>Bcl-2 2870 CST rabbit 1/1000 cleaved-Caspase3 9661 CST rabbit 1/1000</p><p>P53(Acetyl K386) ab52172 Abcam rabbit 1/1000</p><p>P53 BS1565 Bioworld rabbit 1/500</p><p>Bax 2772 CST rabbit 1/1000</p><p>Noxa sc30209 Santa Cruz rabbit 1/200</p><p>Puma ab54288 Abcam rabbit 1/1000</p><p>CD3 ab16669 Abcam rabbit 1/100</p><p>Ly6G 551459 BD Biosciences rat 1/100</p><p>MAC1 ab75476 Abcam rabbit 1/100 p-p65 BS4135 Bioworld rabbit 1/50</p><p>α-actinin 05-384 millipore mouse 1/100 Supplemental Table 2. Primers for Real-time PCR detection.</p><p>Gene Sequence5'---3' GAPDH Forward ACTCCACTCACGGCAAATTC Reverse TCTCCATGGTGGTGAAGACA IL-1β Forward CCGTGGACCTTCCAGGATGA Reverse GGGAACGTCACACACCAGCA IL-6 Forward AGTTGCCTTCTTGGGACTGA Reverse TCCACGATTTCCCAGAGAAC TNF-α Forward CATCTTCTCAAAATTCGAGTGACAA Reverse TGGGAGTAGACAAGGTACAACCC MCP1 Forward TAAAAACCTGGATCGGAACCAAA Reverse GCATTAGCTTCAGATTTACGGGT IFN-γ Forward TGCCAAGTTTGAGGTCAACAACCCA Reverse ACCCCGAATCAGCAGCGACT Noxa Forward ATAACTGTGGTTCTGGCGCA Reverse CAATCCTCCGGAGTTGAGCA Puma Forward ACGACCTCAACGCGCAGTA Reverse TAGTTGGGCTCCATTTCTGG Bax Forward TGAGCGAGTGTCTCCGGCGAAT Reverse GCACTTTAGTGCACAGGGCCTTG Sirt1 Forward TGGAGCAGGTTGCAGGAATCCA Reverse TGGCTTCATGATGGCAAGTGGC Supplemental Table 3. Detailed Information of The Patients Studied</p><p>Type Gender Age (years) cTnI (ng/ml) LVEDd (mm) LVEF (%) IHD Female 67 0.047 90 26 IHD Male 51 0.048 57 26 IHD Male 51 0.029 86 37 IHD Male 42 >50.00 72 30 IHD Male 74 0.735 54 33 IHD Male 63 3.963 87 33 IHD Male 63 0.039 86 25</p><p>IHD: ischemic heart disease; cTnI: cardiac troponin I; LVEDd: left ventricular end-diastolic diameter; LVEF: left ventricular ejection fraction.</p>

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    5 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us