Journal of Cell Science 113, 3241-3253 (2000) 3241 Printed in Great Britain © The Company of Biologists Limited 2000 JCS1491 Biochemical characterization and localization of the dual specificity kinase CLK1 Harry J. Menegay, Michael P. Myers, Fred M. Moeslein and Gary E. Landreth* Alzheimer Research Laboratory, Department of Neurosciences, Case Western Reserve University, School of Medicine, 10900 Euclid Ave., Cleveland, Ohio 44106, USA *Author for correspondence (e-mail: [email protected]) Accepted 1 July 2000; published on WWW 22 August SUMMARY CLK1 was one of the first identified dual specificity kinases negatively regulate CLK1 activity. CLK1 activity is and is the founding member of the ‘LAMMER’ family of positively regulated by phosphorylation on either tyrosine kinases. We have established the substrate site specificity of residues or serine/threonine residues, and is negatively CLK1. We report here that truncation of the N terminus regulated by steric constraints mediated by the N-terminal of CLK1 resulted in a dramatic increase in CLK1 domain, as well as, by phosphorylation on a subset of enzymatic activity, indicating that the N terminus acts as a serine/threonine residues within the catalytic domain. negative regulatory domain. The N-terminal truncation CLK1 mRNA is expressed at low levels in all tissues and resulted in a 45-fold increase in Vmax, suggesting that this cell lines examined. The full-length and truncated splice domain does not contain a pseudo-substrate motif, but may forms are expressed at roughly equivalent levels in most act to conformationally constrain the catalytic activity of tissues. The ratio of the two splice variants of CLK1 can be CLK1. Tyrosine phosphorylation has been proposed to be altered by treatment with cycloheximide. CLK1 protein critical for CLK1 activity, however, CLK1 activity was expression is limited to a small subset of highly localized unaffected by exposure to tyrosine phosphatases. neuronal populations in the rat brain. Contrary to previous Treatment of CLK1 with the serine/threonine specific studies using overexpression systems, we show that CLK1 phosphatase PP2A, resulted in a 2- to 6-fold increase in protein is primarily found in the cytoplasm of these cells, enzymatic activity. Incubation of CLK1 with tyrosine with only a small fraction localized to the nucleus. phosphatases in combination with PP2A abolished CLK1 activity. These data suggest that CLK1 is regulated by three distinct mechanisms that serve to both positively and Key words: Phosphatase, Cytoplasmic, Neuronal INTRODUCTION the dual specificity kinases is indistinguishable from that of the serine/threonine kinases. Traditionally, protein kinases have been divided into two non- One of the first dual specificity kinases to be discovered was overlapping families: the protein tyrosine kinases and the CLK1 (cdc2-like kinase (Ben-David et al., 1991; Howell et al., serine/threonine kinases (Hanks and Quinn, 1991; Hanks et al., 1991; Johnson and Smith, 1991). CLK1, also termed STY, was 1988). The protein tyrosine kinase family largely consists of initially isolated in a screen designed to identify tyrosine the receptor protein kinases and cytoplasmic tyrosine kinases kinases (Ben-David et al., 1991; Howell et al., 1991). CLK1 linked to intracellular signaling mechanisms (Ullrich and has been shown to autophosphorylate on serine, threonine and Schlessinger, 1990). The remainder of protein kinases belong tyrosine residues and phosphorylate exogenous substrates on to the serine/threonine family of protein kinases and are serine and threonine residues (Ben-David et al., 1991; Duncan involved in the regulation of a wide variety of cellular functions et al., 1995; Howell et al., 1991). Tyrosine phosphorylation of (Hanks and Hunter, 1995). These two distinct families were CLK1 has been proposed to be an important determinant of originally identified based on conserved amino acid motifs enzyme activity, as the majority of CLK1 activity can be within their catalytic domains (Hanks et al., 1988). Due to the immunoprecipitated with antibodies to phosphotyrosine absolute specificity for their respective substrate residues, it (Howell et al., 1991). CLK1 has recently been shown to belong was believed that protein kinases exclusively phosphorylated to a small subfamily of protein kinases which contains at least either tyrosine residues or serine/threonine residues. The recent four highly conserved isoforms CLK1, CLK2, CLK3, and discovery of protein kinases capable of phosphorylating all CLK4 (Hanes et al., 1994; Nayler et al., 1997). CLK three hydroxyl amino acids, termed the dual specificity kinases, homologues have been isolated from a number of organisms has forced a re-evaluation of protein kinase specificity including: Arabidopsis, Drosophila, mouse and human (Ben- (Lindberg et al., 1992). Surprisingly, the catalytic domain of David et al., 1991; Duncan et al., 1995; Hanes et al., 1994; 3242 H. J. Menegay and others Howell et al., 1991; Johnson and Smith, 1991). All four amplified using a plasmid containing the full length CLK1 cDNA as isoforms have a highly conserved domain structure. The a template and the high fidelity Vent polymerase (New England conserved kinase domain is located at the C terminus of the Biolabs). Expression of CLK1 was induced by stimulating 500 ml of molecule and contains the signature amino acid motif mid-log phase bacteria with 1 mM IPTG for 4 hours at 30°C. The ‘EHLAMMERILG’ in subdomain X, which has led these cells were harvested by centrifugation, resuspended in 3 ml of sonication buffer (50 mM NaH2PO4, 10 mM Tris, 100 mM NaCl, pH kinases to be dubbed ‘LAMMER’ kinases (Hanes et al., 1994; 8.0) containing 20 µg/ml polymyxin B (Sigma) and incubated on ice Yun et al., 1994). The 160 amino acid N-terminal domain has for 10 minutes. The resuspended cells were sonicated 3× 1 minute and been proposed to comprise a putative regulatory domain and then centrifuged for 10 minutes to clear the lysate. Cleared lysates includes a bipartite nuclear localization signal (Duncan et al., from hexahistidine-CLK1 cells were bound in batch to 1 ml of Talon 1995). With the exception of the nuclear localization signals, Affinity Resin (Clontech), while GST-CLK1 lysates were bound to 1 the N-termini of the CLK isoforms are only distantly related ml of glutathione Sepharose (Pharmacia). The resins were washed 3 (Hanes et al., 1994). Surprisingly, mRNAs for all four CLK times with 10 ml of sonication buffer and then 3 more times with isoforms are alternatively spliced to produce proteins in which sonication buffer at pH 7.4. Hexahistidine-CLK1 was eluted with an the kinase domain is missing, resulting in the expression of imidizole elution buffer (250 mM imidizole, 10 mM Tris, 30% proteins which comprise only the putative N-terminal ethylene glycol, pH 8.0) while GST-CLK1 was eluted with a glutathione elution buffer (10 mM glutathione, 10 mM Tris, 30% regulatory sequences (Duncan et al., 1995; Hanes et al., 1994). ethylene glycol, pH 8.0). A CLK1 N-terminal truncation (trCLK1) Mutations in the Drosophila CLK homologue, darkener of was created by PCR using the following PCR primers apricot (DOA) suggest that CLK family members play an (5′CGGGATCCGGGGAAGAGTCACCGAAGG3′, 5′CCCGGAT- important role during development. Mutations in DOA are TCCTCACGTATGCTTTTTAAGTGG3′) which truncate the 128 N- embryonic lethal and lead to defects in differentiation, terminal amino acids leaving the entire CLK1 kinase domain intact. including abnormalities in segmentation, eye formation, and The PCR was performed using a plasmid containing the full length neuronal development (Yun et al., 1994). The importance of CLK1 and Vent polymerase. The PCR product was cloned into pGEX- CLK family members during neuronal development is 2T and the GST-trCLK1 fusion protein purified as described. supported by the finding that expression of CLK1 in PC12 cells Protein kinase assays causes the cells to undergo neuronal differentiation (Myers et The protein kinase assays employed in these studies utilized 0.5 µg al., 1994). The ability of CLK1 to differentiate PC12 cells was of recombinant CLK1 in the presence of 1 µg of myelin basic protein 32 associated with the CLK1-dependent activation of members of (MBP), 10 mM MgCl2, 2 mM MnCl2, 10 µM [γ- P]ATP (44 the MAP kinase cascade, suggesting that CLK1 normally dpm/fmol) in kinase buffer (10 mM Tris, 1 mM EGTA, 100 µM functions in signal transduction cascades (Myers et al., 1994). sodium ortho-vanadate, 20 mM p-nitrophenyl phosphate (PNP), pH Indeed, the Arabadopsis CLK1 homologue, AFC1, 7.4) in a reaction volume of 50 µl. The reactions were incubated at complements mutations in the yeast MAP kinases KSS1 and room temperature for 20 minutes and stopped with the addition of 3× FUS3 (Bender and Fink, 1994). Both CLK1 and CLK2 have Laemmli sample buffer and boiled. The reaction products were recently been shown to phosphorylate and activate the tyrosine separated by SDS-PAGE and visualized by autoradiography of the dried gels using a phosphoimager (Molecular Dynamics). phosphatase PTP1B (Moeslein et al., 1999). CLK1 may also Incorporation of radioactivity into MBP was quantitated by play a role in regulating RNA splicing, as CLK1 has been Cherenkov counting of MBP-containing gel fragments. MBP peptides found to form complexes with and phosphorylate members of (LC Laboratories), S6 Peptide (UBI), PKCζ substrate peptide (from the SR family of splicing factors (Colwill et al., 1996a,b) and Dr M. Wooten), Tau peptide (from Dr S. Feinstein), Myosin peptide has been shown to affect the splicing of mRNA (Duncan et al., (from Dr T. Egelhof), and Crebtide were used at a concentration of 1997). It has recently been demonstrated that this affect is the 50 µM under standard reaction conditions. Peptide kinase reactions result of the phosphorylation of SR proteins, but not other were stopped by the addition of BSA to 0.2% and TCA to 7% and essential splicing factors (Prasad et al., 1999).