EBAG9 (NM 001278938) Human Untagged Clone Product Data

EBAG9 (NM 001278938) Human Untagged Clone Product Data

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC334501 EBAG9 (NM_001278938) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: EBAG9 (NM_001278938) Human Untagged Clone Tag: Tag Free Symbol: EBAG9 Synonyms: EB9; PDAF Vector: pCMV6 series Fully Sequenced ORF: >NCBI ORF sequence for NM_001278938, the custom clone sequence may differ by one or more nucleotides ATGGCCATCACCCAGTTTCGGTTATTTAAATTTTGTACCTGCCTAGCAACAGTATTCTCATTCCTAAAGA GATTAATATGCAGATCTGGCAGAGGACGGAAATTAAGTGGAGACCAAATAACTTTGCCAACTACAGTTGA TTATTCATCAGTTCCTAAGCAGACAGATGTTGAAGAGTGGACTTCCTGGGATGAAGATGCACCCACCAGT GTAAAGATCGAAGGAGGGAATGGGAATGTGGCAACACAACAAAATTCTTTGGAACAACTGGAACCTGACT ATTTTAAGGACATGACACCAACTATTAGGAAAACTCAGAAAATTGTTATTAAGAAGAGAGAACCATTGAA TTTTGGCATCCCAGATGGGAGCACAGGTTTCTCTAGTAGATTAGCAGCTACACAAGATCTGCCTTTTATT CATCAGTCTTCTGAATTAGGTGACTTAGATACCTGGCAGGAAAATACCAATGCATGGGAAGAAGAAGAAG ATGCAGCCTGGCAAGCAGAAGAAGTTCTGAGACAGCAGAAACTAGCAGACAGAGAAAAGAGAGCAGCCGA ACAACAAAGGAAGAAAATGGAAAAGGAAGCACAACGGCTAATGAAGAAGGAACAAAACAAAATTGGTGTG AAACTTTCATAA Restriction Sites: SgfI-MluI ACCN: NM_001278938 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). RefSeq: NM_001278938.1, NP_001265867.1 RefSeq Size: 2208 bp RefSeq ORF: 642 bp Locus ID: 9166 UniProt ID: O00559, A0A024R9E0 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 EBAG9 (NM_001278938) Human Untagged Clone – SC334501 Protein Families: Druggable Genome Gene Summary: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us