Eye (2013) 27, 367–373 & 2013 Macmillan Publishers Limited All rights reserved 0950-222X/13 www.nature.com/eye 1 2 2 2 Severe Meesmann’s H Hassan , C Thaung , ND Ebenezer , G Larkin , CLINICAL STUDY AJ Hardcastle2 and SJ Tuft1;2 epithelial corneal dystrophy phenotype due to a missense mutation in the helix- initiation motif of keratin 12 Abstract Purpose To describe a severe phenotype of protein. The clinical effects are markedly Meesmann’s epithelial corneal dystrophy more severe than the phenotype usually (MECD) and to determine the underlying associated with the Arg135Thr mutation molecular cause. within this motif, most frequently seen in Methods We identified a 30-member family European patients with MECD. affected by MECD and examined 11 of the 14 Eye (2013) 27, 367–373; doi:10.1038/eye.2012.261; affected individuals. Excised corneal tissue published online 7 December 2012 from one affected individual was examined histologically. We used PCR and direct Keywords: corneal epithelium; Meesmann sequencing to identify mutation of the corneal dystrophy; human KRT12 protein coding regions of the KRT3 and KRT12 genes. Introduction Results Cases had an unusually severe phenotype with large numbers of Meesmann’s epithelial corneal dystrophy 1Corneal Service, Moorfields intraepithelial cysts present from infancy and (MECD; OMIM #122100) is an autosomal Eye Hospital NHS they developed subepithelial fibrosis in the dominant inherited change of the corneal Foundation Trust, London, second to third decade. In some individuals, epithelium of the eye characterized by the UK the cornea became superficially vascularized, bilaterally symmetric development of numerous 2 a change accompanied by the loss of intraepithelial cysts.1,2 The cysts are best Department of Ocular clinically obvious epithelial cysts. Visual loss visualized on retroillumination and they are Biology and Therapeutics, UCL Institute of from amblyopia or corneal opacity was most obvious in the inter-palpebral zone. They Ophthalmology, London, UK common and four individuals were visually are typically 50 mmindiameterwhenmeasured impaired (r6/24 bilaterally) and one was in vivo using confocal microscopy. Although Correspondence: blind (o6/60 bilaterally). In all affected some cases are mild or almost asymptomatic, it is SJ Tuft, Clinical family members, there was a heterozygous more usual for there to be photophobia, Ophthalmology, Moorfields missense mutation c. 395T4C (p. L132P) in discomfort, epiphora, and blurred vision. Eye Hospital, 162 City Road, London EC1V 2PD, exon 1 of the KRT12 gene, which codes for Phenotypic variation within families has been UK. the helix-initiation motif of the K12 described with differences in the numbers and Tel: þ 44 (0)207 566 2045; polypeptide. This sequence change was not distribution of the cysts within the corneal Fax: þ 44 (0)207 566 2019. found in unaffected family members or in epithelium.3 The number of cysts tends to E-mail: [email protected] 100 unaffected controls. increase with age but significant visual loss is Conclusions The Leu132Pro missense unusual. However, painful recurrent corneal Received: 22 June 2012 Accepted in revised form: mutation is within the helix-initiation motif epithelial erosion and subepithelial fibrosis, 31 October 2012 of the keratin and is predicted to result in a particularly in older individuals, has been Published online: 7 significant structural change of the K12 described,1–4 which may cause visual reduction December 2012 KRT12 mutation causes severe form of Meesmann’s H Hassan et al 368 Figure 1 Pedigree of the MECD study family showing autosomal dominant inheritance. Filled circles (female) and squares (male) indicate affected status. Unfilled symbols are unaffected individuals. Strike through indicates deceased. from irregular corneal astigmatism and opacity.4 Light filament structure.8 Here, we report a large family with a microscopy of excised corneal tissue from cases of MECD missense mutation c. 395T4C (p. L132P) within exon 1 of demonstrates a thickened basement membrane with the KRT12 gene in the helix-initiation motif of the K12 periodic acid Schiff (PAS)-positive material deposited on protein that is associated with a very severe phenotype the epithelial basement membrane and within the characterized by corneal scarring, neovascularization, epithelial cells. Electron microscopy shows and marked visual loss and amblyopia in some intracytoplasmic cysts filled with electron dense individuals. material.5,6 The molecular basis for MECD is a mutation of either the KRT3 or KRT12 genes encoding keratins K3 (type II) Patients and methods 7 or K12 (type I). Keratins are proteins that are a The local ethics review board approved this study and component of intermediate filaments that, with we adhered to the guidelines of the Declaration of microfilaments and microtubules, form the flexible Helsinki. Following informed consent, two observers cytoskeleton scaffold found in the cytoplasm of epithelial (GL and ST) examined all available members of a large 8 cells. The genes encoding human keratins are located in white UK family with MECD that exhibited autosomal two compact, gene-dense clusters on chromosomes dominant inheritance (Figure 1). The phenotype was 17q12-q21 (type I keratins) and 12q11-q13 (type II confirmed at slit lamp biomicroscopy and photographs 9 keratins). Functionally, it is usual for a type I (acidic) taken. Vision was measured as Snellen acuity with best keratin to bind with a specific type II (basic or neutral) available visual correction and pinhole viewing. keratin to form an obligate heterodimer.10 At the N- and C-termini, flanking the central rod domain of the keratin proteins, are highly conserved helix-initiation and Histological examination helix-termination motifs.8 These motifs are crucial for hetrodimerization, protein coiling, and keratin fiber The full thickness cornea from individual 2 : 1 (age 78 assembly, and are known to be mutation hot spots. years) was fixed in 10% neutral-buffered formalin. It was m Disruption of either of the constituent keratins in the then processed into paraffin wax. We cut 4 m sections heterodimer pair results in cell fragility and disruption.11 that were then stained with hematoxylin and eosin and To date, mutations in over 54 different keratin genes have PAS stains by conventional methods. Subsequently, part been shown to cause over 90 different clinical disorders of the cornea specimen was dewaxed and reprocessed of human epidermal and epithelial structure.9,12 These into resin for electron microscopy. Semi-thin (750 nm) act as dominant negative (antimorphic) mutations in resin sections were stained with Toluidine blue for light which the defective gene product acts antagonistically to microscopy, and then ultrathin (80 nm) sections cut and the product of the wild-type allele. stained with uranyl acetate. These were examined on a Numerous disease causing mutations within the JEOL 1010, transmission electron microscope (Welwyn coding region of either the KRT12 gene (21 mutations) or Garden City, UK). the KRT3 gene (three mutations) have been described for MECD. All mutations reported to date are missense point Molecular genetics mutations, with the exception of one frameshift mutation in exon 6 of the KRT12 gene.4,9,13 KRT12 (exons 1 or 6) Genomic DNA was extracted from peripheral blood and KRT3 (exon 7) mutations are confined to those samples from all participating family members using regions encoding the helix-initiation or helix-termination standard methods. Exon 7 of the KRT3 gene encoding K3 motifs and they are highly detrimental to intermediate and exons 1 and 6 of the KRT12 gene encoding K12 were Eye KRT12 mutation causes severe form of Meesmann’s H Hassan et al 369 selected for initial sequence analysis. The primers used aspirated, 200 ml of 70% ethanol added to the DNA pellet for amplification are available on request. and the sample was centrifuged at 13 000 r.p.m. for Exons were amplified in a PCR reaction of 25 ml 10 min. The DNA pellet was then re-suspended in 11 ml composed of 150 ng DNA (3 ml), 12.5 ml2Â Mastermix formamide and denatured at 95 oC for 5 min. The (AB-0575, Abgene, Thermo Fisher Scientific, Waltham, samples were analyzed on an ABI 3730 (Applied MA, USA), 3 ml of 2 mM forward primer, 3 mlof2mM Biosystems). The sequences generated from affected and reverse primer, and 3.5 mldH2O. Cycling conditions were unaffected patients were compared with the reference 941C for 5 min followed by 34 cycles of 941C for 30 s, sequence (obtained from UCSC hg19 build) using annealing temperature (Ta) 1C for 30 s, 721C for 45 s, Lasergene DNA Star software (DNA Star Inc, Madison, followed by 1 cycle of 721C for 5 min. PCR products were WI, USA). analyzed by agarose gel electrophoresis. All amplified To test for segregation of the mutation in the extended products were then enzymatically purified. family, exon 1 of the KRT12 gene was amplified and A2-ml volume of PCR product was added to 1 ml bidirectionally sequenced in all affected and unaffected ExoSAP-IT (GE Healthcare Ltd, Little Chalfont, UK) to a individuals. A control DNA panel (100 samples, 200 final volume of 26 ml. The samples were incubated at chromosomes) of white UK donors with no known 371C for 15 min and heat inactivated at 801C for 15 min. ophthalmic condition (ECACC, Health Protection An aliquot (13 ml) of purified PCR product was then Agency Culture Collections) was screened to test if the bidirectionally sequenced with 1 mlof2mM forward or sequence variant was a rare polymorphism. A fragment reverse primer, 1 ml BigDye (version 3.1, Applied of exon 1 encompassing the mutation was amplified Biosystems, Paisley, UK) and 5 ml sequencing buffer using F;GAAGTTCCATGGCAGGAGGAC and (Applied Biosystems) following the manufacturer R;TTGGAAAATATCAAAGTTGTAGGTG as described protocols. DNA was then precipitated by addition of above. The PCR product was subsequently digested with 26 ml precipitation solution (50 ml 95% Ethanol, 2 ml 3 M MseI (New England Biolabs, Hitchin, UK) because the NaOAc pH 5.2) on ice for 10 min before centrifugation at mutation abolished an MseI restriction site.