The EMBO Journal vol.4 no.12 pp.3153-3157, 1985 Molecular cloning of S-protein, a link between complement, coagulation and cell-substrate adhesion Dieter Jenne' and Keith K.Stanley2 bystander cells against lysis by fluid phase C5b-7 and the inhibi- lInstitute of Medical Microbiology, Justus-Liebig-University in Giessen, tion of C9 polymerisation during fluid phase assembly. Schubertstrasse 1, 6300 Giessen, and 2European Molecular Biology S-protein may also have a physiological role in the coagulation Laboratory, Meyerhofstrasse 1, Postfach 10.2209, 6900 Heidelberg, FRG pathway since S-protein can be observed in a complex with Communicated by R.Cortese thrombin in serum (after coagulation), but not in plasma (Podack and Muller-Eberhard, 1979). This complex has been shown to cDNA clones coding for human S-protein have been isolated be a stable trimolecular complex containing antithrombin HI in using monoclonal antibodies to screen a cDNA library in pEX. addition (Jenne et al., 1985a). S-protein can modulate the ac- These clones are shown to be authentic S-protein clones on tivity of thrombin by annulling the heparin-dependent activation the basis of sequence, composition and immunological criteria. ofthe thrombin inhibitor, antithrombin Il (Preissner et al., 1985), The complete open reading frame sequence for S-protein has and by a direct reduction of antithrombin IH inhibition of throm- been determined and shows it to be a single polypeptide chain bin (Jenne et al., 1985a). of 459 amino acids preceded by a cleaved leader peptide of Here we report the molecular cloning and cDNA sequence of 19 residues. No evidence was found for polymorphism of S- S-protein. Comparison of this sequence with partial peptide se- protein suggesting that different molecular weight forms arise quence data of the serum spreading factor called 'vitronectin' by proteolytic degradation. Of the first 44 amino-terminal (Holmes, 1967; Hayman et al., 1982, 1983; Barnes and Silnutzer, residues 42 are identical with the so-called somatomedin B 1983) shows that the two proteins are identical. peptide suggesting that S-protein is the somatomedin B precursor. Striking homology is found in the rest of the se- quence with the serum spreading factor, vitronectin, which Results has also been shown to contain somatomedin B sequences at Identification and sequencing of S-protein cDNA its amino terminus. We conclude that S-protein and vitronec- A mixture of five monoclonal antibodies raised against S-protein tin are identical and discuss the relevance of this finding to purified from SC5b-9 complexes (Jenne et al., 1985b) was used the coagulation and complement pathways. to screen a subcloned human liver cDNA expression library in Key words: cell spreading/SC5b-9 complex/somatomedin B/ the bacterial expression vector, pEX (Stanley and Luzio, 1984). thrombin/vitronectin From 30 000 independent clones in the library we obtained five clones which expressed antigenic determinants of S-protein (Figure 1). These were colony purified and found to contain Introduction cDNA inserts which cross-hybridised. All the clones contained S-protein is found at high concentrations in human plasma large open reading frames assessed by the size of the hybrid pro- (140-700 jig/ml, Podack and Miiller-Eberhard, 1979; Jenne et teins on Western blots showing that the S-protein antigenic deter- al., 1985b; Dahlback and Podack, 1985) and is able to bind to minants were unlikely to be expressed from cDNA fragments protein complexes in the terminal stages of both the complement fused to the expression vector in missense reading frames. The and coagulation pathways. Stable complexes of S-protein with the terminal complement components have been observed after (a) Si C5 is activated via the alternative pathway (Kolb and Muller- S2 Eberhard, 1975; Bhakdi and Roth, 1981), in C8- or C9-depleted S3/S4/S5 serum (Podack et al., 1977; Bhakdi and Roth, 1981), and with S108 detergent-solubilised C5b-9 (Bhakdi and Tranum-Jensen, 1982b). S203 In all these situations the C5b-7 complex is generated in the S5.1 absence of a target lipid bilayer. Binding of S-protein to this fluid SS2 phase C5b-7 may prevent its attachment to cell membranes, and (b) Apal rStuI) Apal Pvun NaeI ApaI although C8 and a few molecules of C9 can still bind (Kolb and the terminal complex contain- lc) 4w 4w *. -*. -4- cytolytic ----0- Miiller-Eberhard, 1975), -4- ing polymerised C9 is not formed (Podack et al., 1984; Dahlback -4- and Podack, 1985). SC5b-9 complex formation has also been ----w inferred during complement attack on some bacteria (Joiner et al., 1982) and in systemic lupus erythematosus (Falk et al., 0 500 1000 1500 1985). If the S-protein is dissociated from the fluid phase com- Fig. 1. S-protein cDNA clones. (a) Clones SI to S5 were obtained by plex by detergent or proteolytic treatment apolar surfaces become expression screening of a human liver cDNA library in pEX. Clones S108 and the resulting complexes aggregate (Bhakdi et al., and S203 were obtained by DNA hybnrdisation screening of a parent library exposed in pKT218. (b) Shows the assembled structure of the S-protein cDNA with 1979; Podack and Miller-Eberhard, 1980; Bhakdi and Tranum- restriction enzyme sites as described in the text. The open box represents Jensen, 1982a). The functions of S-protein may therefore be the the open reading frame. (c) Shows the overlapping M13 clones used to solubilisation of fluid phase C5b-9 complexes, the protection of sequence the cDNA. (©) IRL Press Limited, Oxford, England 3153 D.Jenne and K.K.Stanley 150 M AP LORP L L IL ALL -15 200 A W V A L A D _Q E S C K G R C T E G F N V D K K C Q C D E L C S V V (a)D 0 E S C K G R C T E G F N V D K K C Q C D K L C S V V 1 10 20 201 ACCAGAGCTGCTGCACAGACTATACGGCTGAGTGCAAGCCCCAAGTGACTCGCGGGGATGTGTTCACTATGCCGGAGGATGAGTACACGGTCTATGACGA 300 Q C C T D Y T A E C K P Q V T R G D V F T M P E D E Y T V S D D Q 5 N C T C V T A E C K P Q V T (b)P E L E V T V Y D S 30 40 50 60 301 TGGCGAGGAGAAAAACAATGCCACTGTCCATGAACAGGTGGGGGGCCCCTCCCTGACCTCTGACCTCCAGGCCCAGTCCAAAGGGAATCCTGAGCAGACA 400 G EE K N N A T V R EQ V G G P S L T S D L 0 A QOS K G N P EQ T G EE K N S AT V ? Q V G 70 80 90 401 CTTCGACTAGAAGCCGGCGGTGCCTTACTAGGTGCCAGCGGCCTACAGAA 500 P V L K P EKEE A P AP E V G AS K P EGSI DO 0 P ET L N P D R P 100 110 120 501 O P P A KEE EL COD K PPF D A FT D L K N GOSL F A FORG 0 V C 130 140 150 160 601 CTATGAACTGGACGAAAAGGCAGTGAGGCCTGGGTACCCCAAGCTCATCCGAGATGTCTGGGGCATCGAGGGCCCCATCGATGCCGCCTTCACCCGCATC 700 Y E L D E K A V R P G V P K L I R D V W G ISE G PSI D A A FT MOI 170 180 190 701 800 N C Q G K TVY L F K DRN 0 V W R F ED G V L D P D V PMR NI S D G F (c)P 0 V P C F I S C G F 200 210 220 801 900 D D IP DRN V D A A LA L P A RHS V S G RE R V VPF F K G K Q V W ?FOIP ? N V? A 230 240 250 260 GGAGTACCAGTTCCAGCACCAGCCCAGTCAGGAGGAGTGTGAAGGCAGCTCCCTGTCGGCTGTGTTT'GAACACTTTGCCATGATGCAGCGGGACAGCTGG 1000 K Y Q F 0 NOQ P S Q E EC E GOSS L S A V F ENH PAN NONQ D S W 270 280 290 1001 EDOI F E LL F W D R TOS A G TOG P Q FISKR D W N G V P G Q V D 300 310 320 1101 1200 A A MADG ROIY IOSG M A PR P S L T K K Q N FM NORN OK GYMR (d)A P 0 P 5 L A K K Q R F 0 N 0 N R K G V 0 330 340 350 360 1201 1300 O ORG NO RDG R N O N 0MRM P0 A_M_W L S L P S S E E S N L G SOQRD NOSR D R NOQN 0MM P S 370 380 390 1301 GCAACAGTATCGAGATGTGGCGCCTTACCTCGGGCTTCTTTGGCATCACA 1400 A N N V D DVY RNM D W L V P AT C K P0I00 V F F FOSG D K Y Y R V 400 410 420 1401 N LORT R R V D T V D P P V P RO I A Q V W L G C P AP GOH 440 450 1501 GCGGCAAGCGGCTTTGTCTCCCTTCTCCACCAAAGCCTGCCAAAAAAAAA 1600 1601 AAAA 1604 Fig. 2. The nucleotide and amino acid sequence of S-protein. Random fragments of clones S108 and the ends of S203 were sequenced in M13 and assembled by computer. The deduced amino acid sequence is shown in single letter code beneath the DNA sequence together with the sequence of fragments of the proteins somatomedin B (a) and vitronectin (b - d). Fragments (b) and (d) were generated by cyanogen bromide cleavage while fragment (c) was cleaved using acid (Suzuki et al., 1984). Underlined asparagine residues are possible sites for attachment of N-linked oligosaccharide, and the dashed lines show the amino-terminal sequences of S-protein fragments previously determined (Dahlback and Podack, 1985).