Journal of Inorganic Biochemistry 91 (2002) 59–69 www.elsevier.com/locate/jinorgbio R eactivity of recombinant and mutant vanadium bromoperoxidase from the red alga Corallina officinalis Jayme N. Carter, Kimberly E. Beatty, Matthew T. Simpson, Alison Butler* Department of Chemistry and Biochemistry, University California Santa Barbara, Santa Barbara, CA 93106-9510, USA Received 19 November 2001; received in revised form 1 February 2002; accepted 4 February 2002 Abstract Vanadium bromoperoxidase (VBPO) from the marine red alga Corallina officinalis has been cloned and heterologously expressed in Esherichia coli. The sequence for the full-length cDNA of VBPO from C. officinalis is reported. Steady state kinetic analyses of monochlorodimedone bromination reveals the recombinant enzyme behaves similarly to native VBPO from the alga. The kinetic Br2 HO22 parameters (Kmm51.2 mM, K 517.0 mM) at the optimal pH 6.5 for recombinant VBPO are similar to reported values for enzyme purified from the alga. The first site-directed mutagenesis experiment on VBPO is reported. Mutation of a conserved active site histidine residue to alanine (H480A) results in the loss of the ability to efficiently oxidize bromide, but retains the ability to oxidize iodide. Kinetic I2 HO22 parameters (Kmm533 mM, K 5200 mM) for iodoperoxidase activity were determined for mutant H480A. The presence of conserved consensus sequences for the active sites of VBPO from marine sources shows its usefulness in obtaining recombinant forms of VBPO. Furthermore, mutagenesis of the conserved extra-histidine residue shows the importance of this residue in the oxidation of halides by hydrogen peroxide. 2002 Elsevier Science Inc. All rights reserved. Keywords: Vanadium; Haloperoxidase; Cloning; Expression; Mutant 1 . Introduction pong mechanism [3,4]. The oxidized halogen intermediate can act to halogenate an appropriate organic substrate or Vanadium bromoperoxidases (VBPO) are enzymes that oxidize a second equivalent of hydrogen peroxide to catalyze halide oxidation by hydrogen peroxide. These produce dioxygen in the singlet excited state (Scheme 1) enzymes, isolated from the major classes of marine algae, [5,6]. It has also been established that bromination of are thought to function in the biosynthesis of halogenated organic substrates by vanadium bromoperoxidase proceeds marine natural products [1,2], the scope of which ranges through an electrophilic (i.e. Br1 ) rather than a radical from halogenated indoles, terpenes and acetogenins to process (Br? ) process [7]. volatile halogenated hydrocarbons. In many cases the Recently the X-ray crystal structure of native VBPO halogenated compounds are of pharmacological interest from the brown alga Ascophyllum nodosum and the red due to their biological activities (e.g. antimicrobial, an- alga Corallina officinalis have been solved to 2.0 and 2.3 tifungal, antiinflammatory, antiviral, etc.). Catalytically active vanadium bromoperoxidase requires one equivalent of vanadium (V) per subunit of enzyme. Using vanadium as the cofactor, these bromoperoxidases catalyze the two-electron oxidation of bromide and iodide by hydrogen peroxide in a substrate-inhibited bi-bi ping- *Corresponding author. Tel.: 11-805-893-8178. E-mail address: [email protected] (A. Butler). Scheme 1. 0162-0134/02/$ – see front matter 2002 Elsevier Science Inc. All rights reserved. PII: S0162-0134(02)00400-2 60 J.N. Carter et al. / Journal of Inorganic Biochemistry 91 (2002) 59 –69 A˚ resolution, respectively. The vanadium (V) atom in the off the coast of Santa Barbara California, and frozen at X-ray structure of A. nodosum VBPO (AnVBPO) resides in 280 8C. a trigonal bipyrimidal coordination geometry similar to the Total RNA was prepared from the alga by phenol–SDS vanadium (V) site in vanadium chloroperoxidase (VCPO) extraction methods [12] and poly(A)1 RNA was further [8]. Vanadium (V) in the form of vanadate ion, is axially isolated using the PolyATract mRNA isolation system coordinated by a histidine residue (His486 ) in AnVBPO. (Promega). A double stranded cDNA library was prepared The negatively charged cofactor is neutralized by several from poly(A)1 RNA (5 mg), using the Zap cDNA syn- hydrogen bond interactions from side chain residues at the thesis kit and the Zap cDNA cloning kit according to active site. The protein residues (Ser416 , Gly 417 , Lys 341 , manufacturer’s instructions (Stratagene). Arg349 Nh1 , Nh2 , Arg 480 Nh2 , His 418 ) act as proton donors Polymerase chain reaction (PCR) amplifications with to the oxyanion and constitute the central part of the rigid oligonucleotides designed from the known nucleotide vanadate binding site. The X-ray crystal structure of sequences of VBPO1 and VBPO2 from C. pilulifera were VBPO from C. officinalis (CVBPO) showed the vanadate performed using cDNA prepared from total mRNA iso- binding residues to be identical to residues identified in lated. The upstream primer sequence used, (59- AnVBPO, even though the structure was solved with GCCGAGGGCAGCCCATTCCATCC-39) codes for the inorganic phosphate in place of vanadate [9]. amino acid sequence [AEGSPFHP] from VBPO1. The The active sites of VBPO for both C. officinalis and A. downstream primer, (59-AAGTAGTGAACACCTG- nodosum contain an additional histidine residue not present CCATGTT-39) codes for the amino acid sequence in VCPO (i.e. His478 CVBPO, sequence reported by Isupov [NMAGVHYF] from VBPO1 [13]. The temperature et al. [9], and His411 AnVBPO). The additional histidine profile was 94 8C for 0.5 min, 51 8C for 0.5 min and 68 8C residue is not coordinated to the vanadate cofactor, but is for 2.0 min for 25 cycles in a Perkin-Elmer thermocycler. proposed to be within hydrogen bonding distance to one of The PCR reactions were performed using high fidelity pfu the vanadate oxygen atoms. It has been proposed that the Turbo DNA polymerase (Stratagene). extra histidine may influence the activated peroxovanadate The single fragment obtained by PCR amplifications intermediate by decreasing its susceptibility to nucleophilic was used to probe a cDNA library from C. officinalis. One attack by chloride during catalysis and may act as a proton million clones were screened by plaque hybridization with donor/acceptor during the enzyme reaction, thus giving 39-end labeled oligonucleotide. The oligonucleotide probe rise to the observed differences in catalytic activities of (59 - GCCGAGGGCAGCCCATTCCATCCGTCCTAC - 39) VCPO and VBPO [8,10,11]. However, the role of this was labeled with fluorescein-11-dUTP using terminal residue has not been fully determined. transferase (ECL 39-oligolabelling module, AP Biotech). In an effort to probe the role of certain active site Phage plaques were transferred to nylon membranes, and residues and to elucidate the functional significance of the the DNA fixed to the membranes by alkali fixation extra histidine residue at the active site we have cloned methods. Following prehybridization of the membranes for VBPO from the red alga Corallina officinalis. In this 2 h at 45 8C in a solution containing 53SSC (0.750 M report we describe the first sequence for the full-length NaCl, 0.075 M sodium citrate, pH 7.0), 0.02% SDS (w/v), cDNA of CVBPO, the deduced amino acid structure, and 100 mg salmon sperm DNA and 53Denhardt’s solution, the bacterial expression system used to obtain recombinant the membranes were hybridized overnight at 45 8C with enzyme. Kinetic parameters for the recombinant protein the fluorescein labeled probe. were determined and found to be similar to the native Membranes were washed several times with 13SSC, enzyme. We also report the first mutational study on the 0.1% SDS at 57 8C. Membranes were prepared for anti- active site of VBPO. As an initial approach to understand- body incubations by blocking the filters at room tempera- ing the function of the additional histidine residue and its ture in 0.1 M Tris–HCl pH 7.5, 0.15 M NaCl and 20-fold influence on halide oxidation (i.e. His480 rCVBPO; this dilution of antibody liquid block solution for 60 min (AP work, as translated from the full nucleotide sequence), the Biotech). The membranes were incubated overnight at effects of mutating the residue His480 to an alanine was room temperature with a 1:5000 dilution of an antifluores- examined. We show that His480 is important for the cein antibody conjugated to horseradish peroxidase (AP oxidation of halides by VBPO and the mutation of the Biotech) in 0.1 M Tris–HCl, pH 7.5, 0.4 M NaCl and 0.5% extra histidine residue influences enzyme–cofactor interac- (w/v) bovine serum albumin, followed by several washes tions. with the same buffer at room temperature. Oligonucleotide probe detection was performed using luminol-based substrates (AP Biotech) with the conjugated 2 . Methods and materials reporter enzyme, HRP. Chemiluminescent signals were detected using ECLீ Hyperfilmீ. Positive clones were 2 .1. cDNA clone isolation and sequencing isolated and in vivo excision of the cDNA insert-con- taining pBluescript phagemids were performed. The cloned Corallina officinalis alga was collected in April of 1998 inserts were sequenced using T3/T7 primers from opposite J.N. Carter et al. / Journal of Inorganic Biochemistry 91 (2002) 59 –69 61 directions by an automated DNA sequencer (Iowa State NH43 VO . Cell lysis was performed using lysozyme treat- University, DNA sequencing facility). ment (100 mg/ml) followed by sonication. Identification of the 59-coding region for the VBPO Soluble protein was purified by modification of the cDNA was carried out by PCR amplification with cDNA protocol described for recombinant VBPO from C. piluli- template using primers designed from the 59-nucleotide fera [13]. In all anion-exchange purification steps KBr salt sequences of VBPO1 and VBPO2, and downstream se- was used instead of NaCl. Active fractions eluting from the quence information obtained by cDNA library screening. DEAE FF anion-exchange column were heat shock treated The forward primer in the reaction was 59-at658C for 20 min followed by immediate centrifugation ATGGGTATTCCAGCTGACAAC-39 and the reverse at 16 000 g.