
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Crossref Hindawi Publishing Corporation Case Reports in Infectious Diseases Volume 2016, Article ID 6318064, 4 pages http://dx.doi.org/10.1155/2016/6318064 Case Report Bacteremia Caused by Kocuria kristinae from Egypt: Are There More? A Case Report and Review of the Literature Reem M. Hassan,1 Dina M. Bassiouny,1 and Yomna Matar2 1 Department of Clinical and Chemical Pathology, Faculty of Medicine, Cairo University, Cairo, Egypt 2Department of Psychiatry, Faculty of Medicine, Cairo University, Cairo, Egypt Correspondence should be addressed to Reem M. Hassan; [email protected] Received 1 July 2016; Accepted 12 October 2016 Academic Editor: Pau Montesinos Fernandez´ Copyright © 2016 Reem M. Hassan et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Kocuria kristinae is opportunistic Gram-positive cocci from the family Micrococcaceae. It is usually considered part of the normal flora that rarely is isolated from clinical specimens. Here, we report a case of Kocuria kristinae bacteremia; to the best of our knowledge, this is the first report from Egypt. 1. Introduction antipsychotic regimen (risperidone, depakine, and quetiap- ine). A peripheral cannula was introduced for intravascular Kocuria are Gram-positive, coccoid actinobacteria that occur fluids. The patient was not controlled with regular treatment in tetrads belonging to the family Micrococcaceae, suborder and received aqueous intramuscular injection of clopixol Micrococcineae, order Actinomycetales [1]. They are widely 200 mg, after which she developed bilateral lower limb weak- distributedinnatureandcanalsobefoundfrequentlyas ness, disturbed conscious level a day later, and fever. Weak- normal skin and oral cavity flora in humans and other mam- ness progressed to hypotonia and external rotation, with no mals.Thegenuscontains18species,onlyfiveofwhichare rigidity and equivocal plantar reflex. Manifestations in the knowntobeopportunisticpathogens[2]. right limb were severer than in the left one, as there were Few reports on Kocuria spp. clinical infections exist in redness, warmness, and edema of calf muscles but no pain or the literature. They were reported to cause catheter-related tenderness. The patient received clexane 40 mg prophylaxis. ∘ bacteremia in immunocompromised patients and those with Examination of the patient revealed temperature 38.3 C, chronic illness, peritonitis, cholecystitis, and urinary tract blood pressure 130/80 mmHg, pulse 110/min, and respiratory infection in patients with indwelling urinary catheters [3–6]. rate 20/min. The underestimated prevalence of this organism is due to Radiological investigations were done in the form of CT its misidentification as coagulase-negative staph and absence of guidelines for its clinical evaluation as a pathogen as it can brain, MRI brain, and echocardiogram, which were normal, be a common source of contamination in clinical specimens and venous Duplex on lower limbs that showed recent adher- [7, 8]. ent deep venous thrombosis (DVT) in right peroneal and soleal areas for which she received a higher dose of clexane (60 mg every 12 hours). 2. Case Report Laboratory investigations were done and results were as A 70-year-old female patient diagnosed with bipolar disease follows: CPK was 3200 U/L which gradually decreased later was admitted to the psychiatry department in Cairo Uni- on, AST was 94 U/L, platelets were 87000 cells/cmm, Na was versity Hospital (Kasr Al-Ainy). The patient develops manic/ 134 mg/dL, K was 3.5 mg/dL, Ca++ was 0.61 mg/dL, Hb was depressive episodes every now and then and was in an episode 10 mg/dL, WBCs were 3600 cells/cmm, CRP was positive, PT of mania for which she received treatment for 2 weeks, regular and PTT were normal, and urine culture grew E. coli (ESBL). 2 Case Reports in Infectious Diseases gi|506209907|emb|HF985357.1| Kocuria marina partial 16S rRNA gene isolate F80 gi|451170740|emb|HF585351.1| Kocuria marina partial 16S rRNA gene isolate D102 gi|105295533|emb|AM269448.1| Kocuria rhizophila partial 16S rRNA gene isolate H1 gi|298357267|emb|FN908446.1| Kocuria rhizophila partial 16S rRNA gene isolate LE 78 gi|702073252|emb|LN589846.1| Kocuria varians partial 16S rRNA gene isolate G6 gi|396937422|emb|HE962221.1| Kocuria rosea partial 16S rRNA gene isolate 43/5 gi|729057851|gb|KM577653.1| Kocuria kristinae strain 3 uB I 16S ribosomal RNA gene partial sequence Unknown isolate gi|169882149|gb|EU518711.1| Kocuria kristinae isolate GN-NO6-23.3 16S ribosomal RNA gene partial sequence gi|756983973|emb|LN714836.1| Kocuria rosea partial 16S rRNA gene isolate HMA12 gi|485659506|gb|JX861555.1| Kocuria kristinae strain MCCC1A07678 16S ribosomal RNA gene partial sequence gi|8489159|gb|AF195448.1|AF195448 Kocuria varians 16S ribosomal RNA gene partial sequence 0.6 0.5 0.4 0.3 0.2 0.1 0.0 Figure 1: Evolutionary relationships of taxa. The evolutionary history was inferred using the UPGMA method [10]. Microbiological Methods. Blood culture was withdrawn in is known to cause catheter-related bacteremia and infective the BACTEC Plus aerobic/F and BACTEC Plus anaerobic/F endocarditis [2, 17]. blood culture bottles (Becton, Dickinson and Company, In the present case report, we describe a case of catheter- Spain, MD). All bottles were incubated in BACTEC 120 related blood stream infection caused by K. kristinae,compli- instrument. Blood culture grew Gram-positive cocci on cated by DVT,which was the case in other reported infections blood and chocolate agar with catalase-positive, coagulase- caused by Kocuria spp. As the patient had a concomitant negative, and typical pigmentation of Kocuria colonies (pale urinary tract infection (caused by E. coli), the presented fever rose) that became more distinct after further 24 hr incubation couldbecausedeitherbyoneoftheorganismsorevenbythe ∘ in 4 C. Vitek2 automated identification system (bioMerieux, DVT. The patient was not known to be immunocompromised France) was used to identify the isolate using the Gram except for antipsychotic drugs which with prolonged use can positive identification cards (GP cards) and the isolate was cause impaired liver functions with mild state of immune identified as Kocuria kristinae (99%). Susceptibility testing system disturbance. was done using the modified Kirby-Bauer disc diffusion Infection with this organism takes place mostly in immu- method; the organism was found to be sensitive to cefox- nocompromised patients like K. kristinae bacteremia that itin, gentamicin, amikacin, ciprofloxacin, levofloxacin, and occurred in a patient suffering from ovarian cancer. This linezolid but resistant to vancomycin, teicoplanin, rifampicin, patient had multiple febrile episodes through a period of six amoxicillin/clavulanate, and clindamycin. Phenotypic iden- months, all of which grew the organism from several blood tification was confirmed by performing a molecular assay, cultures and central venous lines (CVLs) [18]. namely, 16S rRNA gene sequencing, as previously described K. kristinae was also described as the cause of acute using the primer sets 536f 5 CAGCAGCCGCGGTAATAC peritonitis in a patient with end-stage renal failure that had and RP2 5 eACGGCACCTTGTTACGACTT (AccuOligo, CAPD for two years. The source of contamination was sus- Bioneer, Daejeon, Korea), BigDye5 Terminator v3.1 cycle pected to be touch of the catheter that led to access of bacteria sequencing kit (Applied Biosystems, Foster City, CA, USA), into the peritoneal cavity [4, 19]. and the BigDye Xterminator6 purification kit (Applied Bio- An immunocompetent pregnant female developed severe systems, Foster City, CA, USA), and then run on Applied Bio- K. kristinae intravascular infections with suppurative throm- systems 3500 Genetic Analyzer (Applied Biosystems, Foster bosis that led to septic pulmonary emboli. These complica- City, CA, USA). Sequences were analyzed with AutoAssem- tions followed catheter-related blood stream infection [3]. bler software (KB 3500 POP7 BDTv3.mob) and compared A recent report of K. kristinae bacteremia discussed an using the basic local alignment search tool. Also, a neighbor- infant with a history of prolonged diarrhea complicated with joining phylogenetic tree with the 16S rRNA gene sequences black hairy tongue symptoms [20]. of all Kocuria species using MEGA6 program (Figure 1) was A different access route of K. kristinae infection was constructed [9–12]. recently documented in an elderly diabetic patient who devel- oped endocarditis after amputation of a forefoot ulcer and the 3. Discussion central venous catheter was not involved [21]. Many recent studies, including ours, correctly identified By reviewing the literature, 20 reports on Kocuria infections Kocuria spp. using the Vitek-2 ID-GPC Gram-positive iden- in humans were found, most of which were in immuno- tification card, perhaps due to the recently introduced larger compromised hosts with few reports in otherwise healthy database that allows the identification of additional taxa [22]. people. The five opportunistic Kocuria spp. are K. kristinae, Misidentification among members of the Kocuria genus K. rhizophila, K. rosea, K. varians,andK. marina [3, 13–16]. cannot be ruled out as other studies have reported such K. kristinae was first described in 1974 (previously known situations [5, 13, 14].
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages5 Page
-
File Size-